Incidental Mutation 'R4650:Slco1a4'
ID351215
Institutional Source Beutler Lab
Gene Symbol Slco1a4
Ensembl Gene ENSMUSG00000030237
Gene Namesolute carrier organic anion transporter family, member 1a4
SynonymsOatp2, Oatp1a4, Slc21a5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141805440-141856199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141812698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 529 (I529K)
Ref Sequence ENSEMBL: ENSMUSP00000130746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032364] [ENSMUST00000165990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032364
AA Change: I529K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032364
Gene: ENSMUSG00000030237
AA Change: I529K

DomainStartEndE-ValueType
Pfam:OATP 19 598 3.2e-196 PFAM
Pfam:MFS_1 22 421 9.2e-27 PFAM
Pfam:Kazal_2 445 486 5e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165990
AA Change: I529K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130746
Gene: ENSMUSG00000030237
AA Change: I529K

DomainStartEndE-ValueType
Pfam:OATP 21 597 3.2e-164 PFAM
Pfam:MFS_1 22 421 7.2e-27 PFAM
Pfam:Kazal_2 445 486 6.8e-11 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Slco1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Slco1a4 APN 6 141807182 critical splice acceptor site probably null
IGL01573:Slco1a4 APN 6 141812851 splice site probably benign
IGL01735:Slco1a4 APN 6 141817751 missense probably benign 0.00
IGL03115:Slco1a4 APN 6 141819603 missense probably benign 0.05
IGL03115:Slco1a4 APN 6 141817859 missense probably damaging 1.00
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0305:Slco1a4 UTSW 6 141817753 missense possibly damaging 0.47
R0511:Slco1a4 UTSW 6 141830860 splice site probably benign
R0660:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R0664:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R1589:Slco1a4 UTSW 6 141845447 missense probably benign
R1606:Slco1a4 UTSW 6 141839611 missense probably damaging 1.00
R1665:Slco1a4 UTSW 6 141839577 missense possibly damaging 0.79
R1742:Slco1a4 UTSW 6 141825045 missense probably benign 0.07
R1763:Slco1a4 UTSW 6 141812731 missense probably benign 0.26
R1893:Slco1a4 UTSW 6 141834616 unclassified probably null
R1908:Slco1a4 UTSW 6 141815447 critical splice donor site probably null
R1944:Slco1a4 UTSW 6 141839550 missense probably benign 0.00
R2144:Slco1a4 UTSW 6 141809378 missense probably damaging 1.00
R2276:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.49
R2340:Slco1a4 UTSW 6 141841377 missense probably benign 0.00
R3017:Slco1a4 UTSW 6 141812670 splice site probably null
R3769:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R4577:Slco1a4 UTSW 6 141819540 missense probably damaging 0.97
R4801:Slco1a4 UTSW 6 141845497 start gained probably benign
R4802:Slco1a4 UTSW 6 141845497 start gained probably benign
R4896:Slco1a4 UTSW 6 141815505 missense possibly damaging 0.91
R5126:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.94
R5183:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R5399:Slco1a4 UTSW 6 141830707 missense probably damaging 0.98
R5645:Slco1a4 UTSW 6 141834659 missense possibly damaging 0.95
R5650:Slco1a4 UTSW 6 141809394 missense possibly damaging 0.69
R5832:Slco1a4 UTSW 6 141819544 missense probably benign 0.00
R6180:Slco1a4 UTSW 6 141817820 missense possibly damaging 0.95
R6415:Slco1a4 UTSW 6 141834689 nonsense probably null
R6992:Slco1a4 UTSW 6 141819604 missense probably benign 0.05
R7024:Slco1a4 UTSW 6 141834708 missense probably benign 0.00
R7696:Slco1a4 UTSW 6 141810511 nonsense probably null
R7751:Slco1a4 UTSW 6 141834687 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAGCATTGTCTTCCAAAGGAC -3'
(R):5'- CGTGTCATTGACCCCAACAC -3'

Sequencing Primer
(F):5'- CAAAGGACGTTGTTTTTAGTGGCAC -3'
(R):5'- CCCAATGGGCTTTGTAGAAAATACTG -3'
Posted On2015-10-08