Incidental Mutation 'R4650:Ltbp4'
ID351217
Institutional Source Beutler Lab
Gene Symbol Ltbp4
Ensembl Gene ENSMUSG00000040488
Gene Namelatent transforming growth factor beta binding protein 4
Synonyms2310046A13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27305136-27337692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27314309 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1092 (C1092S)
Ref Sequence ENSEMBL: ENSMUSP00000113674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175] [ENSMUST00000125455]
Predicted Effect probably damaging
Transcript: ENSMUST00000038618
AA Change: C1158S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: C1158S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108369
AA Change: C1157S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: C1157S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118583
AA Change: C1092S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: C1092S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 2.3e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 2.2e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 7.1e-15 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118961
AA Change: C1092S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488
AA Change: C1092S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 1.6e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121175
AA Change: C1092S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: C1092S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 3.4e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 3.3e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 1e-14 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
EGF_CA 1550 1594 9.54e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125455
SMART Domains Protein: ENSMUSP00000120326
Gene: ENSMUSG00000040488

DomainStartEndE-ValueType
Pfam:TB 9 52 1.9e-14 PFAM
Pfam:TB 85 127 6e-16 PFAM
low complexity region 133 145 N/A INTRINSIC
low complexity region 162 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206413
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Ltbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ltbp4 APN 7 27328805 missense probably damaging 0.96
IGL00585:Ltbp4 APN 7 27326733 missense probably damaging 0.98
IGL01320:Ltbp4 APN 7 27328359 splice site probably benign
IGL01860:Ltbp4 APN 7 27319646 missense probably damaging 1.00
IGL02026:Ltbp4 APN 7 27327417 nonsense probably null
IGL02226:Ltbp4 APN 7 27306934 missense probably damaging 1.00
IGL02422:Ltbp4 APN 7 27319672 missense probably damaging 1.00
IGL02611:Ltbp4 APN 7 27310655 missense probably damaging 1.00
IGL02892:Ltbp4 APN 7 27310649 missense probably damaging 1.00
IGL02926:Ltbp4 APN 7 27328872 splice site probably null
IGL02950:Ltbp4 APN 7 27306718 missense probably damaging 0.99
IGL03008:Ltbp4 APN 7 27324364 missense probably damaging 0.99
IGL03271:Ltbp4 APN 7 27329815 missense unknown
IGL02837:Ltbp4 UTSW 7 27314381 missense probably damaging 1.00
R0792:Ltbp4 UTSW 7 27325060 missense probably damaging 1.00
R0980:Ltbp4 UTSW 7 27324162 missense probably damaging 1.00
R1017:Ltbp4 UTSW 7 27306076 missense possibly damaging 0.95
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1448:Ltbp4 UTSW 7 27306577 missense possibly damaging 0.86
R1575:Ltbp4 UTSW 7 27322820 missense probably damaging 1.00
R1918:Ltbp4 UTSW 7 27337569 unclassified probably benign
R1932:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R1959:Ltbp4 UTSW 7 27329018 missense unknown
R1960:Ltbp4 UTSW 7 27329018 missense unknown
R1976:Ltbp4 UTSW 7 27326770 missense probably damaging 1.00
R2060:Ltbp4 UTSW 7 27308953 missense probably damaging 1.00
R2333:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R2431:Ltbp4 UTSW 7 27319676 missense possibly damaging 0.91
R3125:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R4093:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4095:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4592:Ltbp4 UTSW 7 27325183 missense probably damaging 0.96
R4610:Ltbp4 UTSW 7 27306700 missense probably damaging 1.00
R4912:Ltbp4 UTSW 7 27306116 nonsense probably null
R5002:Ltbp4 UTSW 7 27327685 frame shift probably null
R5016:Ltbp4 UTSW 7 27327685 frame shift probably null
R5216:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5218:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327321 missense probably benign 0.01
R5539:Ltbp4 UTSW 7 27327724 missense probably damaging 0.97
R5991:Ltbp4 UTSW 7 27309316 missense probably damaging 1.00
R6082:Ltbp4 UTSW 7 27335680 unclassified probably benign
R6125:Ltbp4 UTSW 7 27327755 missense probably damaging 1.00
R6146:Ltbp4 UTSW 7 27319724 missense probably damaging 0.99
R6156:Ltbp4 UTSW 7 27330162 missense unknown
R6414:Ltbp4 UTSW 7 27310715 missense probably damaging 1.00
R6563:Ltbp4 UTSW 7 27309063 missense probably damaging 1.00
R6719:Ltbp4 UTSW 7 27328763 missense probably damaging 0.99
R6940:Ltbp4 UTSW 7 27308944 missense probably damaging 1.00
R7054:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R7116:Ltbp4 UTSW 7 27305427 missense probably damaging 0.99
R7326:Ltbp4 UTSW 7 27329755 missense unknown
R7419:Ltbp4 UTSW 7 27329767 missense unknown
X0025:Ltbp4 UTSW 7 27325802 missense probably damaging 1.00
X0066:Ltbp4 UTSW 7 27306065 critical splice donor site probably null
Z1088:Ltbp4 UTSW 7 27307792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATAGCATTTAACTGATGGTCC -3'
(R):5'- GCCTATAGAGATATGTACCCATTGAG -3'

Sequencing Primer
(F):5'- GGTCCATATTAACAGGTATATGCATG -3'
(R):5'- AATCCAAGGTCTTCTGCAGG -3'
Posted On2015-10-08