Incidental Mutation 'R4650:Serpinb9d'
ID351236
Institutional Source Beutler Lab
Gene Symbol Serpinb9d
Ensembl Gene ENSMUSG00000054266
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9d
SynonymsAT2, ovalbumin, Spi9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33192959-33203129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33202853 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 301 (L301F)
Ref Sequence ENSEMBL: ENSMUSP00000067710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067198]
Predicted Effect probably benign
Transcript: ENSMUST00000067198
AA Change: L301F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000067710
Gene: ENSMUSG00000054266
AA Change: L301F

DomainStartEndE-ValueType
SERPIN 13 377 1.79e-167 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Serpinb9d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Serpinb9d APN 13 33202671 splice site probably null
IGL01610:Serpinb9d APN 13 33198002 missense probably benign 0.12
IGL01702:Serpinb9d APN 13 33203023 missense probably damaging 1.00
IGL01833:Serpinb9d APN 13 33200705 missense probably damaging 1.00
IGL02029:Serpinb9d APN 13 33196529 missense possibly damaging 0.74
IGL03013:Serpinb9d APN 13 33196538 missense probably damaging 1.00
IGL03027:Serpinb9d APN 13 33202715 nonsense probably null
IGL03056:Serpinb9d APN 13 33202753 missense probably damaging 1.00
IGL03189:Serpinb9d APN 13 33202912 missense probably damaging 1.00
IGL03206:Serpinb9d APN 13 33198031 missense possibly damaging 0.61
R0217:Serpinb9d UTSW 13 33198022 missense possibly damaging 0.79
R0370:Serpinb9d UTSW 13 33195966 missense probably damaging 1.00
R1174:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1175:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1711:Serpinb9d UTSW 13 33200748 missense probably benign 0.03
R1716:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R1874:Serpinb9d UTSW 13 33197963 splice site probably null
R2186:Serpinb9d UTSW 13 33203047 missense possibly damaging 0.82
R2497:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R4198:Serpinb9d UTSW 13 33202674 splice site probably null
R4198:Serpinb9d UTSW 13 33202965 missense probably benign 0.01
R4199:Serpinb9d UTSW 13 33202674 splice site probably null
R4584:Serpinb9d UTSW 13 33200616 missense probably damaging 1.00
R5573:Serpinb9d UTSW 13 33196440 critical splice acceptor site probably null
R5627:Serpinb9d UTSW 13 33202693 missense probably damaging 1.00
R6336:Serpinb9d UTSW 13 33194694 missense probably damaging 1.00
R6706:Serpinb9d UTSW 13 33196558 missense probably benign
R6948:Serpinb9d UTSW 13 33200723 missense possibly damaging 0.95
R7271:Serpinb9d UTSW 13 33194634 missense probably benign 0.43
R7336:Serpinb9d UTSW 13 33200719 missense probably benign 0.00
R7436:Serpinb9d UTSW 13 33195933 missense probably benign 0.35
R7675:Serpinb9d UTSW 13 33202776 nonsense probably null
R7874:Serpinb9d UTSW 13 33202671 splice site probably null
R7957:Serpinb9d UTSW 13 33202671 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTGGCTCTGGGTAAAACC -3'
(R):5'- AACAGGATGCTGTTAGTTGTGC -3'

Sequencing Primer
(F):5'- GGCTCTGGGTAAAACCTCATCTG -3'
(R):5'- TTGTGCTGTGCATGATGAAGAAAAG -3'
Posted On2015-10-08