Incidental Mutation 'R4651:Cux1'
ID351281
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R4651 (G1)
Quality Score224
Status Validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136567229 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 4 (N4K)
Ref Sequence ENSEMBL: ENSMUSP00000135512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004097
AA Change: N4K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175918
AA Change: N4K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175975
AA Change: N4K
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176172
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176216
AA Change: N4K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176501
Predicted Effect probably damaging
Transcript: ENSMUST00000176745
AA Change: N4K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176778
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177297
AA Change: N4K

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: N4K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177305
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 intron probably null
Predicted Primers PCR Primer
(F):5'- CGAGTGATCAATGAGAGCCG -3'
(R):5'- CCTTATCCTAAAGCGCTGGC -3'

Sequencing Primer
(F):5'- TCAATGAGAGCCGGGGAGC -3'
(R):5'- TCAGGCTTCGGACTCCATG -3'
Posted On2015-10-08