Mutagenetix > Incidental Mutations

Incidental Mutation 'R4651:Cux1'

351281

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

041911-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4651 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136567229 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 4 (N4K)

Ref Sequence

ENSEMBL: ENSMUSP00000135512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004097
AA Change: N4K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175918
AA Change: N4K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175975
AA Change: N4K

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176172

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176216
AA Change: N4K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176501

Predicted Effect

probably damaging
Transcript: ENSMUST00000176745
AA Change: N4K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176778

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177297
AA Change: N4K

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: N4K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177305

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (98/101)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Ahnak2	T	G	12: 112,774,837	S128R	possibly damaging	Het
Ankrd26	T	C	6: 118,515,826	D1319G	probably benign	Het
Ankrd35	T	C	3: 96,684,027	V543A	probably benign	Het
Ano10	A	T	9: 122,261,115	Y377*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp10b	G	A	11: 43,194,645	G284S	probably damaging	Het
Atp5c1	A	G	2: 10,063,476	F180S	probably damaging	Het
Btnl4	A	G	17: 34,472,628	S296P	probably benign	Het
Cast	A	G	13: 74,746,014	S171P	probably benign	Het
Catsperb	G	A	12: 101,541,512	A513T	probably benign	Het
Ccnf	C	A	17: 24,231,786	R406L	probably damaging	Het
Ceacam12	A	G	7: 18,067,434	T113A	probably damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Col12a1	A	T	9: 79,612,946	D2815E	probably damaging	Het
Cpox	G	T	16: 58,670,687	R87L	possibly damaging	Het
Cttnbp2	A	G	6: 18,434,038	I607T	possibly damaging	Het
Cyp3a25	T	C	5: 145,994,891	T136A	probably benign	Het
Dhx58	T	A	11: 100,701,359	N288Y	probably damaging	Het
Dnah10	T	C	5: 124,729,143	Y127H	probably benign	Het
Dnd1	G	A	18: 36,765,061		probably benign	Het
Ehmt2	C	A	17: 34,913,814	N1171K	probably damaging	Het
Fanci	T	A	7: 79,435,256	M838K	possibly damaging	Het
Flot1	T	C	17: 35,832,544		probably benign	Het
Gad2	A	T	2: 22,668,362	D364V	probably damaging	Het
Gm10375	C	A	14: 43,606,869		probably null	Het
Gm9996	T	A	10: 29,143,758		probably benign	Het
Gnat3	T	A	5: 18,015,570	L247H	probably damaging	Het
Ip6k3	C	T	17: 27,145,291	C261Y	probably damaging	Het
Irgc1	C	A	7: 24,432,813	R193L	probably damaging	Het
Kalrn	G	T	16: 34,176,391	P1477Q	probably damaging	Het
Kyat1	G	T	2: 30,194,064	H15N	probably benign	Het
Lamc1	T	G	1: 153,228,777	S59R	probably damaging	Het
Llgl1	A	G	11: 60,708,651	D486G	possibly damaging	Het
Lrrc9	T	C	12: 72,477,386	W790R	probably damaging	Het
Lsm2	T	A	17: 34,985,595		probably benign	Het
Med8	A	T	4: 118,410,892	E5V	probably damaging	Het
Mefv	A	G	16: 3,717,818	L82P	probably damaging	Het
Mettl3	T	A	14: 52,295,092	I545F	probably damaging	Het
Naa20	CTCTAGA	C	2: 145,911,832		probably benign	Het
Ncapg2	T	A	12: 116,425,787	N342K	probably damaging	Het
Ndufaf6	T	A	4: 11,062,070	Y187F	probably damaging	Het
Nomo1	T	A	7: 46,068,442	I799N	probably damaging	Het
Obscn	G	A	11: 59,038,877	R5824C	probably damaging	Het
Olfr1310	G	T	2: 112,008,250	S312Y	probably damaging	Het
Olfr430	A	G	1: 174,069,828	I177V	possibly damaging	Het
Olfr807	T	C	10: 129,755,418	I11V	probably benign	Het
Olfr849	T	A	9: 19,441,295	C127*	probably null	Het
Pgm3	T	A	9: 86,558,470	R389S	probably benign	Het
Pkd2l2	A	T	18: 34,409,836	R20*	probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Ppp4r3a	T	A	12: 101,082,911		probably benign	Het
Prpf38b	G	A	3: 108,904,092		probably benign	Het
Prpf4b	A	T	13: 34,899,971	M908L	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
Prrc2c	A	T	1: 162,723,274	H40Q	probably damaging	Het
Ptprk	T	C	10: 28,263,690	I137T	probably damaging	Het
Rrnad1	T	C	3: 87,927,672	H107R	probably benign	Het
Sdr42e1	T	C	8: 117,663,621	T94A	probably benign	Het
Setd2	A	G	9: 110,594,132	D2085G	possibly damaging	Het
Sgce	T	C	6: 4,689,560		probably benign	Het
Shisa3	A	G	5: 67,608,649	D81G	probably damaging	Het
Sipa1l1	T	A	12: 82,422,471	L1248*	probably null	Het
Skint7	T	G	4: 111,982,112	M201R	probably damaging	Het
Slc5a3	T	A	16: 92,077,202	V49E	probably benign	Het
Slc9c1	A	T	16: 45,547,393	*163L	probably null	Het
Smyd3	A	G	1: 179,043,741	Y358H	probably benign	Het
Srp68	A	T	11: 116,274,014	S31R	probably benign	Het
Stag1	T	A	9: 100,796,716	M230K	probably damaging	Het
Strc	A	T	2: 121,374,348	D985E	possibly damaging	Het
Syne2	A	G	12: 75,989,239	T3767A	probably damaging	Het
Sytl2	C	A	7: 90,375,425	P207Q	probably damaging	Het
Tbc1d2b	A	G	9: 90,207,887	F863S	probably damaging	Het
Tek	T	C	4: 94,780,884	S41P	probably damaging	Het
Top1	T	C	2: 160,712,717	Y463H	probably damaging	Het
Trim24	T	G	6: 37,957,839		probably null	Het
Trim38	A	T	13: 23,782,969	D133V	probably damaging	Het
Ttn	A	G	2: 76,746,635	V24638A	possibly damaging	Het
Ttn	A	G	2: 76,870,869		probably benign	Het
Tyro3	G	C	2: 119,816,868	G826A	probably benign	Het
Ube2b	A	G	11: 51,995,372		probably null	Het
Ubxn4	T	A	1: 128,274,850	W410R	probably benign	Het
Unc45a	T	C	7: 80,333,029	K383E	possibly damaging	Het
Usp7	A	C	16: 8,698,414		probably benign	Het
Vmn1r193	C	T	13: 22,219,525	G99D	probably damaging	Het
Vrk2	T	C	11: 26,489,803	D256G	probably damaging	Het
Wdr81	A	G	11: 75,451,240	V1067A	probably damaging	Het
Wiz	C	T	17: 32,357,681	R624Q	probably damaging	Het
Zcwpw2	A	G	9: 118,014,051		noncoding transcript	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGAGTGATCAATGAGAGCCG -3'
(R):5'- CCTTATCCTAAAGCGCTGGC -3'

Sequencing Primer
(F):5'- TCAATGAGAGCCGGGGAGC -3'
(R):5'- TCAGGCTTCGGACTCCATG -3'

Posted On

2015-10-08