Incidental Mutation 'R4651:Setd2'
ID351298
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4651 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110594132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2085 (D2085G)
Ref Sequence ENSEMBL: ENSMUSP00000116313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000153838
AA Change: D2085G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: D2085G

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000197655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198697
Predicted Effect unknown
Transcript: ENSMUST00000200460
AA Change: D307G
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 unclassified probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
Predicted Primers PCR Primer
(F):5'- CTGAGGCATCTTTCCAGCTC -3'
(R):5'- CATAGGCTTGCATGGGGTAAC -3'

Sequencing Primer
(F):5'- GTGCTGGATGTTGAATTTAAGCAATC -3'
(R):5'- ATCCCCAAGTTCTGCATC -3'
Posted On2015-10-08