Incidental Mutation 'R0269:Bpifb1'
ID35130
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene NameBPI fold containing family B, member 1
SynonymsLPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission 038495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0269 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154190818-154220369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154212947 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 253 (D253G)
Ref Sequence ENSEMBL: ENSMUSP00000080501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028987
AA Change: D253G

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: D253G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081816
AA Change: D253G

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: D253G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123017
Meta Mutation Damage Score 0.4757 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.1%
  • 20x: 93.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,954,000 V231I possibly damaging Het
Abca1 T C 4: 53,044,228 D1798G probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Amhr2 T C 15: 102,447,068 C189R probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
AW551984 T C 9: 39,599,950 Y153C probably damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Cd46 T G 1: 195,064,688 I339L probably benign Het
Cdkn2aip A G 8: 47,711,977 S234P probably damaging Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Csf2rb2 G T 15: 78,288,865 T265N probably benign Het
Cyp2c40 A G 19: 39,773,896 F436L probably damaging Het
D130040H23Rik T C 8: 69,300,794 F24S probably benign Het
Defb12 G T 8: 19,114,359 A34E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Gldc T A 19: 30,118,602 I670F probably damaging Het
Guf1 A C 5: 69,559,599 Q168P probably damaging Het
Hcn2 A G 10: 79,734,241 probably benign Het
Hddc2 A G 10: 31,327,946 M190V probably benign Het
Kcnq2 T C 2: 181,096,974 E294G probably benign Het
Kdelr1 T A 7: 45,874,039 probably benign Het
Kidins220 T A 12: 25,040,512 H1158Q probably damaging Het
Laptm5 A T 4: 130,930,816 N185Y probably benign Het
Mgat4a A G 1: 37,490,307 Y164H possibly damaging Het
Mlh3 C A 12: 85,268,405 V336L probably benign Het
Myadm A G 7: 3,296,757 T12A unknown Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr954 T C 9: 39,461,794 M118T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Recql5 T C 11: 115,928,224 D172G possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Rgs7 A G 1: 175,270,820 S58P possibly damaging Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Sgsm1 T C 5: 113,286,929 probably null Het
Slc22a19 A T 19: 7,709,621 probably benign Het
Slc6a21 T A 7: 45,286,908 Y428* probably null Het
Smarca4 T G 9: 21,636,201 M260R probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata17 T C 1: 187,097,872 I322V probably benign Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Sult1d1 A T 5: 87,564,802 I61N probably damaging Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Trmt11 T A 10: 30,587,489 H210L probably benign Het
Ush2a T A 1: 188,810,176 M3313K probably benign Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0058:Bpifb1 UTSW 2 154206540 missense possibly damaging 0.54
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3605:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4745:Bpifb1 UTSW 2 154211581 nonsense probably null
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R5724:Bpifb1 UTSW 2 154204792 missense probably benign
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7246:Bpifb1 UTSW 2 154207092 missense probably damaging 1.00
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGCCTGGAATGAGGTTTCCAC -3'
(R):5'- GAATCAGGGCAGAGCTGATCGTTAC -3'

Sequencing Primer
(F):5'- ATCAAAGTCCTCAGACCGTG -3'
(R):5'- CAGAGCTGATCGTTACTGGGAG -3'
Posted On2013-05-09