Incidental Mutation 'R4651:Olfr807'
ID351303
Institutional Source Beutler Lab
Gene Symbol Olfr807
Ensembl Gene ENSMUSG00000050478
Gene Nameolfactory receptor 807
SynonymsMOR117-1, GA_x6K02T2PULF-11434134-11433199
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4651 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129754092-129757793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129755418 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 11 (I11V)
Ref Sequence ENSEMBL: ENSMUSP00000150657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059038] [ENSMUST00000213379] [ENSMUST00000217106]
Predicted Effect probably benign
Transcript: ENSMUST00000059038
AA Change: I11V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049924
Gene: ENSMUSG00000050478
AA Change: I11V

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 3.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 302 3.4e-8 PFAM
Pfam:7tm_1 39 296 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213379
AA Change: I11V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217106
AA Change: I11V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Olfr807
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Olfr807 APN 10 129754655 missense possibly damaging 0.87
IGL03031:Olfr807 APN 10 129755369 missense possibly damaging 0.94
R0691:Olfr807 UTSW 10 129755402 missense probably damaging 1.00
R0848:Olfr807 UTSW 10 129755208 missense probably benign 0.00
R0988:Olfr807 UTSW 10 129754997 missense probably benign 0.03
R1880:Olfr807 UTSW 10 129755421 missense probably benign 0.09
R1894:Olfr807 UTSW 10 129755074 nonsense probably null
R1935:Olfr807 UTSW 10 129754715 missense probably damaging 1.00
R2513:Olfr807 UTSW 10 129755152 missense probably damaging 1.00
R4201:Olfr807 UTSW 10 129754628 missense probably damaging 1.00
R4643:Olfr807 UTSW 10 129754955 missense probably damaging 1.00
R4652:Olfr807 UTSW 10 129755418 missense probably benign
R4797:Olfr807 UTSW 10 129754521 missense probably benign 0.06
R5337:Olfr807 UTSW 10 129754534 nonsense probably null
R5597:Olfr807 UTSW 10 129754886 missense probably damaging 1.00
R6310:Olfr807 UTSW 10 129754659 missense probably benign 0.04
R6442:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6443:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6642:Olfr807 UTSW 10 129755363 missense probably damaging 1.00
R7660:Olfr807 UTSW 10 129754563
Z1088:Olfr807 UTSW 10 129755339 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCTAGGGATGCAAGTAGATGTC -3'
(R):5'- GTAGATCTGACCAATGAGTAAATGTGG -3'

Sequencing Primer
(F):5'- TGCAAGTAGATGTCAGAGAGATTTC -3'
(R):5'- CCAATGAGTAAATGTGGAAACTTAGC -3'
Posted On2015-10-08