Incidental Mutation 'R4651:Vrk2'
ID351304
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Namevaccinia related kinase 2
Synonyms2810003O05Rik
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4651 (G1)
Quality Score123
Status Validated
Chromosome11
Chromosomal Location26471322-26593999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26489803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000105130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000109504]
Predicted Effect probably damaging
Transcript: ENSMUST00000078362
AA Change: D256G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090
AA Change: D256G

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109504
AA Change: D256G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090
AA Change: D256G

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Meta Mutation Damage Score 0.6382 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26535560 missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26471717 missense probably benign 0.10
IGL02185:Vrk2 APN 11 26535638 nonsense probably null
IGL02257:Vrk2 APN 11 26534266 missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26476564 missense probably benign 0.00
macromacro UTSW 11 26549325 missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26534313 splice site probably benign
R0184:Vrk2 UTSW 11 26550046 missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26486959 critical splice donor site probably null
R0751:Vrk2 UTSW 11 26483331 splice site probably benign
R0766:Vrk2 UTSW 11 26535522 splice site probably benign
R1103:Vrk2 UTSW 11 26549325 missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26483331 splice site probably benign
R1312:Vrk2 UTSW 11 26535522 splice site probably benign
R2041:Vrk2 UTSW 11 26547914 missense probably benign 0.01
R2857:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R3615:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R3616:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26547915 missense probably benign 0.00
R4652:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26471611 missense possibly damaging 0.95
R5262:Vrk2 UTSW 11 26591697 missense possibly damaging 0.94
R5458:Vrk2 UTSW 11 26498919 missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26499036 missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26534314 splice site probably benign
R5892:Vrk2 UTSW 11 26534372 intron probably benign
R6054:Vrk2 UTSW 11 26486975 missense probably benign 0.20
R6923:Vrk2 UTSW 11 26489893 missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26535597 missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
R8165:Vrk2 UTSW 11 26535575 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAGTGCCAGAAAACAGCTTGTC -3'
(R):5'- TTGCATATTTCGTCAATGGGAG -3'

Sequencing Primer
(F):5'- CAGCTTGTCTGGAAACTGATG -3'
(R):5'- GCATATTTCGTCAATGGGAGCTCAC -3'
Posted On2015-10-08