Mutagenetix > Incidental Mutations

Incidental Mutation 'R4651:Cast'

351325

Institutional Source

Beutler Lab

Gene Symbol

Cast

Ensembl Gene

ENSMUSG00000021585

Gene Name

calpastatin

Synonyms

MMRRC Submission

041911-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4651 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74692368-74808810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74746014 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 171 (S171P)

Ref Sequence

ENSEMBL: ENSMUSP00000152174 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000222588] [ENSMUST00000223033] [ENSMUST00000223126] [ENSMUST00000223206] [ENSMUST00000231578]

Predicted Effect

probably benign
Transcript: ENSMUST00000065629
AA Change: S137P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585
AA Change: S137P

Domain	Start	End	E-Value	Type
Pfam:Calpain_inhib	15	272	8.1e-9	PFAM
Pfam:Calpain_inhib	279	404	2.7e-36	PFAM
Pfam:Calpain_inhib	415	544	3.6e-38	PFAM
Pfam:Calpain_inhib	556	684	4.5e-36	PFAM
low complexity region	708	744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222588
AA Change: S69P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000223033
AA Change: S88P

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000223126
AA Change: S69P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000223206
AA Change: S171P

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000231578
AA Change: S152P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1272

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Ahnak2	T	G	12: 112,774,837	S128R	possibly damaging	Het
Ankrd26	T	C	6: 118,515,826	D1319G	probably benign	Het
Ankrd35	T	C	3: 96,684,027	V543A	probably benign	Het
Ano10	A	T	9: 122,261,115	Y377*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp10b	G	A	11: 43,194,645	G284S	probably damaging	Het
Atp5c1	A	G	2: 10,063,476	F180S	probably damaging	Het
Btnl4	A	G	17: 34,472,628	S296P	probably benign	Het
Catsperb	G	A	12: 101,541,512	A513T	probably benign	Het
Ccnf	C	A	17: 24,231,786	R406L	probably damaging	Het
Ceacam12	A	G	7: 18,067,434	T113A	probably damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Col12a1	A	T	9: 79,612,946	D2815E	probably damaging	Het
Cpox	G	T	16: 58,670,687	R87L	possibly damaging	Het
Cttnbp2	A	G	6: 18,434,038	I607T	possibly damaging	Het
Cux1	A	T	5: 136,567,229	N4K	probably damaging	Het
Cyp3a25	T	C	5: 145,994,891	T136A	probably benign	Het
Dhx58	T	A	11: 100,701,359	N288Y	probably damaging	Het
Dnah10	T	C	5: 124,729,143	Y127H	probably benign	Het
Dnd1	G	A	18: 36,765,061		probably benign	Het
Ehmt2	C	A	17: 34,913,814	N1171K	probably damaging	Het
Fanci	T	A	7: 79,435,256	M838K	possibly damaging	Het
Flot1	T	C	17: 35,832,544		probably benign	Het
Gad2	A	T	2: 22,668,362	D364V	probably damaging	Het
Gm10375	C	A	14: 43,606,869		probably null	Het
Gm9996	T	A	10: 29,143,758		probably benign	Het
Gnat3	T	A	5: 18,015,570	L247H	probably damaging	Het
Ip6k3	C	T	17: 27,145,291	C261Y	probably damaging	Het
Irgc1	C	A	7: 24,432,813	R193L	probably damaging	Het
Kalrn	G	T	16: 34,176,391	P1477Q	probably damaging	Het
Kyat1	G	T	2: 30,194,064	H15N	probably benign	Het
Lamc1	T	G	1: 153,228,777	S59R	probably damaging	Het
Llgl1	A	G	11: 60,708,651	D486G	possibly damaging	Het
Lrrc9	T	C	12: 72,477,386	W790R	probably damaging	Het
Lsm2	T	A	17: 34,985,595		probably benign	Het
Med8	A	T	4: 118,410,892	E5V	probably damaging	Het
Mefv	A	G	16: 3,717,818	L82P	probably damaging	Het
Mettl3	T	A	14: 52,295,092	I545F	probably damaging	Het
Naa20	CTCTAGA	C	2: 145,911,832		probably benign	Het
Ncapg2	T	A	12: 116,425,787	N342K	probably damaging	Het
Ndufaf6	T	A	4: 11,062,070	Y187F	probably damaging	Het
Nomo1	T	A	7: 46,068,442	I799N	probably damaging	Het
Obscn	G	A	11: 59,038,877	R5824C	probably damaging	Het
Olfr1310	G	T	2: 112,008,250	S312Y	probably damaging	Het
Olfr430	A	G	1: 174,069,828	I177V	possibly damaging	Het
Olfr807	T	C	10: 129,755,418	I11V	probably benign	Het
Olfr849	T	A	9: 19,441,295	C127*	probably null	Het
Pgm3	T	A	9: 86,558,470	R389S	probably benign	Het
Pkd2l2	A	T	18: 34,409,836	R20*	probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Ppp4r3a	T	A	12: 101,082,911		probably benign	Het
Prpf38b	G	A	3: 108,904,092		probably benign	Het
Prpf4b	A	T	13: 34,899,971	M908L	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
Prrc2c	A	T	1: 162,723,274	H40Q	probably damaging	Het
Ptprk	T	C	10: 28,263,690	I137T	probably damaging	Het
Rrnad1	T	C	3: 87,927,672	H107R	probably benign	Het
Sdr42e1	T	C	8: 117,663,621	T94A	probably benign	Het
Setd2	A	G	9: 110,594,132	D2085G	possibly damaging	Het
Sgce	T	C	6: 4,689,560		probably benign	Het
Shisa3	A	G	5: 67,608,649	D81G	probably damaging	Het
Sipa1l1	T	A	12: 82,422,471	L1248*	probably null	Het
Skint7	T	G	4: 111,982,112	M201R	probably damaging	Het
Slc5a3	T	A	16: 92,077,202	V49E	probably benign	Het
Slc9c1	A	T	16: 45,547,393	*163L	probably null	Het
Smyd3	A	G	1: 179,043,741	Y358H	probably benign	Het
Srp68	A	T	11: 116,274,014	S31R	probably benign	Het
Stag1	T	A	9: 100,796,716	M230K	probably damaging	Het
Strc	A	T	2: 121,374,348	D985E	possibly damaging	Het
Syne2	A	G	12: 75,989,239	T3767A	probably damaging	Het
Sytl2	C	A	7: 90,375,425	P207Q	probably damaging	Het
Tbc1d2b	A	G	9: 90,207,887	F863S	probably damaging	Het
Tek	T	C	4: 94,780,884	S41P	probably damaging	Het
Top1	T	C	2: 160,712,717	Y463H	probably damaging	Het
Trim24	T	G	6: 37,957,839		probably null	Het
Trim38	A	T	13: 23,782,969	D133V	probably damaging	Het
Ttn	A	G	2: 76,746,635	V24638A	possibly damaging	Het
Ttn	A	G	2: 76,870,869		probably benign	Het
Tyro3	G	C	2: 119,816,868	G826A	probably benign	Het
Ube2b	A	G	11: 51,995,372		probably null	Het
Ubxn4	T	A	1: 128,274,850	W410R	probably benign	Het
Unc45a	T	C	7: 80,333,029	K383E	possibly damaging	Het
Usp7	A	C	16: 8,698,414		probably benign	Het
Vmn1r193	C	T	13: 22,219,525	G99D	probably damaging	Het
Vrk2	T	C	11: 26,489,803	D256G	probably damaging	Het
Wdr81	A	G	11: 75,451,240	V1067A	probably damaging	Het
Wiz	C	T	17: 32,357,681	R624Q	probably damaging	Het
Zcwpw2	A	G	9: 118,014,051		noncoding transcript	Het

Other mutations in Cast

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Cast	APN	13	74736974	missense	probably damaging	1.00
IGL01363:Cast	APN	13	74704192	missense	possibly damaging	0.95
IGL01404:Cast	APN	13	74738287	nonsense	probably null
IGL01893:Cast	APN	13	74727289	nonsense	probably null
IGL02139:Cast	APN	13	74728365	missense	possibly damaging	0.80
IGL02444:Cast	APN	13	74739853	missense	probably damaging	1.00
IGL02927:Cast	APN	13	74736994	missense	probably damaging	1.00
IGL02941:Cast	APN	13	74700687	missense	probably damaging	1.00
IGL02799:Cast	UTSW	13	74736752	missense	probably damaging	1.00
R0583:Cast	UTSW	13	74713678	missense	probably damaging	0.99
R2031:Cast	UTSW	13	74798652	splice site	probably null
R2256:Cast	UTSW	13	74739905	missense	probably damaging	0.99
R2509:Cast	UTSW	13	74737616	missense	probably benign	0.19
R3923:Cast	UTSW	13	74728413	missense	probably damaging	1.00
R4116:Cast	UTSW	13	74724837	missense	probably damaging	1.00
R4649:Cast	UTSW	13	74746014	missense	probably benign	0.25
R4652:Cast	UTSW	13	74746014	missense	probably benign	0.25
R4653:Cast	UTSW	13	74746014	missense	probably benign	0.25
R4714:Cast	UTSW	13	74798715	missense	probably damaging	1.00
R4751:Cast	UTSW	13	74746047	missense	probably damaging	1.00
R4758:Cast	UTSW	13	74739880	missense	possibly damaging	0.90
R4974:Cast	UTSW	13	74807823	missense	probably benign
R5040:Cast	UTSW	13	74724813	missense	probably damaging	1.00
R5397:Cast	UTSW	13	74720937	missense	possibly damaging	0.83
R5556:Cast	UTSW	13	74695889	critical splice donor site	probably null
R5863:Cast	UTSW	13	74736756	missense	probably damaging	1.00
R6030:Cast	UTSW	13	74695937	missense	possibly damaging	0.83
R6030:Cast	UTSW	13	74695937	missense	possibly damaging	0.83
R6349:Cast	UTSW	13	74721195	missense	probably damaging	1.00
R6817:Cast	UTSW	13	74699158	missense	possibly damaging	0.78
R6829:Cast	UTSW	13	74728344	missense	possibly damaging	0.50
R6848:Cast	UTSW	13	74695933	missense	possibly damaging	0.66
R7275:Cast	UTSW	13	74727334	missense	probably benign	0.00
R7401:Cast	UTSW	13	74808458	missense	unknown
R7408:Cast	UTSW	13	74739841	missense	probably damaging	0.99
R7602:Cast	UTSW	13	74736965	missense	probably benign	0.26
R8032:Cast	UTSW	13	74735241	nonsense	probably null
R8499:Cast	UTSW	13	74798716	missense	probably benign	0.07
R8544:Cast	UTSW	13	74734058	missense	possibly damaging	0.92
R8557:Cast	UTSW	13	74704182	missense	probably damaging	1.00
X0011:Cast	UTSW	13	74725456	missense	probably damaging	1.00
X0066:Cast	UTSW	13	74736979	missense	probably damaging	1.00
Z1177:Cast	UTSW	13	74725463	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAAATCTACCTGCTAGCCTTCC -3'
(R):5'- TGGGATCTACTACCACTTGGAGTC -3'

Sequencing Primer
(F):5'- AGGCACTCCATTATCCCATATTC -3'
(R):5'- ACCACTTGGAGTCTTCAGTG -3'

Posted On

2015-10-08