Incidental Mutation 'R4652:Angptl2'
ID351353
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
MMRRC Submission 041912-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4652 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33243883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 406 (D406Y)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably damaging
Transcript: ENSMUST00000004208
AA Change: D406Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: D406Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Meta Mutation Damage Score 0.9740 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (111/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,639,611 Q131L probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
A830018L16Rik C A 1: 11,537,342 probably benign Het
Adam26b A G 8: 43,521,338 V209A possibly damaging Het
Adh6a T A 3: 138,326,115 M256K probably benign Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arfgef1 C T 1: 10,173,262 D1021N probably damaging Het
Arhgap17 G A 7: 123,286,618 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp13a4 A T 16: 29,452,603 D498E probably damaging Het
C4a T A 17: 34,810,131 noncoding transcript Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Camsap3 A C 8: 3,600,689 K223T possibly damaging Het
Cast A G 13: 74,746,014 S171P probably benign Het
Cdh8 T A 8: 99,024,859 D742V probably benign Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cers3 G A 7: 66,781,856 probably null Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Cntn5 C A 9: 9,704,912 K832N possibly damaging Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Ctf2 T C 7: 127,719,384 T148A probably benign Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Dhx36 A T 3: 62,500,998 L140M probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dlgap1 T A 17: 70,761,095 Y554N probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnah6 T C 6: 73,070,597 M3140V probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dyrk1a C T 16: 94,692,065 T719I probably benign Het
Erlin1 T A 19: 44,040,792 K234* probably null Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Frmd4b T C 6: 97,295,755 H846R probably benign Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm27047 T C 6: 130,630,516 noncoding transcript Het
Gm7168 A G 17: 13,949,807 R479G possibly damaging Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
H2-D1 T G 17: 35,266,516 probably null Het
Hpf1 T G 8: 60,893,730 S26R possibly damaging Het
Ift80 T A 3: 68,914,940 N627I probably benign Het
Inpp5d A G 1: 87,665,451 K91R probably benign Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Man1a2 A G 3: 100,632,561 L188P probably damaging Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl25 A T 10: 105,779,648 C498* probably null Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Mvp T A 7: 126,993,549 I397F probably damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Nudt5 G A 2: 5,856,065 probably benign Het
Nyap2 T A 1: 81,336,729 D713E probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Orc4 A T 2: 48,936,750 probably benign Het
Pde10a T A 17: 8,757,053 N3K possibly damaging Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Piwil4 G A 9: 14,712,308 R529* probably null Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prkg1 T C 19: 30,595,012 T400A probably damaging Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptcd1 A T 5: 145,155,175 H371Q probably benign Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rapgef5 G A 12: 117,714,128 G366E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,919 probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sfxn3 A G 19: 45,050,874 probably null Het
Sgce T C 6: 4,689,560 probably benign Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc18a1 A G 8: 69,043,931 M360T possibly damaging Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Tarsl2 T A 7: 65,689,969 V704E probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Txndc11 A G 16: 11,075,122 S915P probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vmn2r109 T A 17: 20,541,394 K567M probably damaging Het
Vmn2r23 T C 6: 123,741,730 F681L probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCGATGGTGAGTACTGGC -3'
(R):5'- AGTGTCATTGTCTGAAGGCAG -3'

Sequencing Primer
(F):5'- CTGGGCCTGGAGAACATCTACTG -3'
(R):5'- TTGGTAAAGCTGCCTGACAC -3'
Posted On2015-10-08