Incidental Mutation 'R4652:Vmn2r23'
ID 351380
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 041912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4652 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123718689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 681 (F681L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: F681L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: F681L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (111/117)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 125,366,350 (GRCm39) Q131L probably damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4933409G03Rik G A 2: 68,436,559 (GRCm39) E168K unknown Het
A830018L16Rik C A 1: 11,607,566 (GRCm39) probably benign Het
Adam26b A G 8: 43,974,375 (GRCm39) V209A possibly damaging Het
Adh6a T A 3: 138,031,876 (GRCm39) M256K probably benign Het
Ahnak2 T G 12: 112,741,271 (GRCm39) S128R possibly damaging Het
Angptl2 G T 2: 33,133,895 (GRCm39) D406Y probably damaging Het
Ano10 A T 9: 122,090,181 (GRCm39) Y377* probably null Het
Arfgef1 C T 1: 10,243,487 (GRCm39) D1021N probably damaging Het
Arhgap17 G A 7: 122,885,841 (GRCm39) probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atp10b G A 11: 43,085,472 (GRCm39) G284S probably damaging Het
Atp13a4 A T 16: 29,271,421 (GRCm39) D498E probably damaging Het
C4a T A 17: 35,029,108 (GRCm39) noncoding transcript Het
Cacna1d C T 14: 29,817,365 (GRCm39) M1232I probably benign Het
Camsap3 A C 8: 3,650,689 (GRCm39) K223T possibly damaging Het
Cast A G 13: 74,894,133 (GRCm39) S171P probably benign Het
Cdh8 T A 8: 99,751,491 (GRCm39) D742V probably benign Het
Ceacam12 A G 7: 17,801,359 (GRCm39) T113A probably damaging Het
Cers3 G A 7: 66,431,604 (GRCm39) probably null Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Cntn5 C A 9: 9,704,917 (GRCm39) K832N possibly damaging Het
Col12a1 A T 9: 79,520,228 (GRCm39) D2815E probably damaging Het
Ctf2 T C 7: 127,318,556 (GRCm39) T148A probably benign Het
Cttnbp2 A G 6: 18,434,037 (GRCm39) I607T possibly damaging Het
Cux1 A T 5: 136,596,083 (GRCm39) N4K probably damaging Het
Dhx36 A T 3: 62,408,419 (GRCm39) L140M probably benign Het
Dhx58 T A 11: 100,592,185 (GRCm39) N288Y probably damaging Het
Dlgap1 T A 17: 71,068,090 (GRCm39) Y554N probably damaging Het
Dnah10 T C 5: 124,806,207 (GRCm39) Y127H probably benign Het
Dnah6 T C 6: 73,047,580 (GRCm39) M3140V probably benign Het
Dnd1 G A 18: 36,898,114 (GRCm39) probably benign Het
Dpy19l1 A C 9: 24,393,350 (GRCm39) S140A possibly damaging Het
Dyrk1a C T 16: 94,492,924 (GRCm39) T719I probably benign Het
Erlin1 T A 19: 44,029,231 (GRCm39) K234* probably null Het
Fndc7 T C 3: 108,770,135 (GRCm39) N597S probably benign Het
Folh1 C A 7: 86,393,633 (GRCm39) G360* probably null Het
Frmd4b T C 6: 97,272,716 (GRCm39) H846R probably benign Het
Gm10375 C A 14: 43,844,326 (GRCm39) probably null Het
Gm27047 T C 6: 130,607,479 (GRCm39) noncoding transcript Het
Gm7168 A G 17: 14,170,069 (GRCm39) R479G possibly damaging Het
Gm9996 T A 10: 29,019,754 (GRCm39) probably benign Het
Gnat3 T A 5: 18,220,568 (GRCm39) L247H probably damaging Het
H2-D1 T G 17: 35,485,492 (GRCm39) probably null Het
Hpf1 T G 8: 61,346,764 (GRCm39) S26R possibly damaging Het
Ift80 T A 3: 68,822,273 (GRCm39) N627I probably benign Het
Inpp5d A G 1: 87,593,173 (GRCm39) K91R probably benign Het
Irgc C A 7: 24,132,238 (GRCm39) R193L probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lamc1 T G 1: 153,104,523 (GRCm39) S59R probably damaging Het
Lrrc9 T C 12: 72,524,160 (GRCm39) W790R probably damaging Het
Man1a2 A G 3: 100,539,877 (GRCm39) L188P probably damaging Het
Med8 A T 4: 118,268,089 (GRCm39) E5V probably damaging Het
Mefv A G 16: 3,535,682 (GRCm39) L82P probably damaging Het
Mettl25 A T 10: 105,615,509 (GRCm39) C498* probably null Het
Mettl3 T A 14: 52,532,549 (GRCm39) I545F probably damaging Het
Mvp T A 7: 126,592,721 (GRCm39) I397F probably damaging Het
Nlrp14 A T 7: 106,781,024 (GRCm39) I74F probably benign Het
Nudt5 G A 2: 5,860,876 (GRCm39) probably benign Het
Nyap2 T A 1: 81,314,444 (GRCm39) D713E probably damaging Het
Obscn G A 11: 58,929,703 (GRCm39) R5824C probably damaging Het
Or4f6 G T 2: 111,838,595 (GRCm39) S312Y probably damaging Het
Or6c214 T C 10: 129,591,287 (GRCm39) I11V probably benign Het
Orc4 A T 2: 48,826,762 (GRCm39) probably benign Het
Pde10a T A 17: 8,975,885 (GRCm39) N3K possibly damaging Het
Pgm3 T A 9: 86,440,523 (GRCm39) R389S probably benign Het
Piwil4 G A 9: 14,623,604 (GRCm39) R529* probably null Het
Pkd2l2 A T 18: 34,542,889 (GRCm39) R20* probably null Het
Ppp4r3a T A 12: 101,049,170 (GRCm39) probably benign Het
Prkcq T C 2: 11,284,333 (GRCm39) V501A possibly damaging Het
Prkg1 T C 19: 30,572,412 (GRCm39) T400A probably damaging Het
Prps2 T C X: 166,135,288 (GRCm39) D183G probably damaging Het
Prrc2c A T 1: 162,550,843 (GRCm39) H40Q probably damaging Het
Ptcd1 A T 5: 145,091,985 (GRCm39) H371Q probably benign Het
Ptprk T C 10: 28,139,686 (GRCm39) I137T probably damaging Het
R3hdm1 T C 1: 128,112,181 (GRCm39) S422P probably damaging Het
Rapgef5 G A 12: 117,677,863 (GRCm39) G366E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,126 (GRCm39) probably benign Het
Setd2 A G 9: 110,423,200 (GRCm39) D2085G possibly damaging Het
Sfxn3 A G 19: 45,039,313 (GRCm39) probably null Het
Sgce T C 6: 4,689,560 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,469,245 (GRCm39) L1248* probably null Het
Skint7 T G 4: 111,839,309 (GRCm39) M201R probably damaging Het
Slc18a1 A G 8: 69,496,583 (GRCm39) M360T possibly damaging Het
Srp68 A T 11: 116,164,840 (GRCm39) S31R probably benign Het
Stag1 T A 9: 100,678,769 (GRCm39) M230K probably damaging Het
Strc A T 2: 121,204,829 (GRCm39) D985E possibly damaging Het
Tars3 T A 7: 65,339,717 (GRCm39) V704E probably damaging Het
Tbc1d2b A G 9: 90,089,940 (GRCm39) F863S probably damaging Het
Tek T C 4: 94,669,121 (GRCm39) S41P probably damaging Het
Top1 T C 2: 160,554,637 (GRCm39) Y463H probably damaging Het
Trim24 T G 6: 37,934,774 (GRCm39) probably null Het
Ttn A G 2: 76,576,979 (GRCm39) V24638A possibly damaging Het
Ttn A G 2: 76,701,213 (GRCm39) probably benign Het
Txndc11 A G 16: 10,892,986 (GRCm39) S915P probably benign Het
Tyro3 G C 2: 119,647,349 (GRCm39) G826A probably benign Het
Ubxn4 T A 1: 128,202,587 (GRCm39) W410R probably benign Het
Vmn1r193 C T 13: 22,403,695 (GRCm39) G99D probably damaging Het
Vmn2r109 T A 17: 20,761,656 (GRCm39) K567M probably damaging Het
Vrk2 T C 11: 26,439,803 (GRCm39) D256G probably damaging Het
Vwa3a T A 7: 120,378,138 (GRCm39) I476N probably damaging Het
Wdr81 A G 11: 75,342,066 (GRCm39) V1067A probably damaging Het
Zcwpw2 A G 9: 117,843,119 (GRCm39) noncoding transcript Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTCTGCACGGCCATTAGTTTATC -3'
(R):5'- TGATGTGACCAAACTCTGAGTG -3'

Sequencing Primer
(F):5'- GGATACACCCATTGTCAGAGC -3'
(R):5'- CTCTGAGTGCATGTCAACATCAGG -3'
Posted On 2015-10-08