Incidental Mutation 'R4652:Setd2'
ID351406
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission 041912-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R4652 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110594132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2085 (D2085G)
Ref Sequence ENSEMBL: ENSMUSP00000116313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000153838
AA Change: D2085G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: D2085G

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000197655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198697
Predicted Effect unknown
Transcript: ENSMUST00000200460
AA Change: D307G
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (111/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,639,611 Q131L probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
A830018L16Rik C A 1: 11,537,342 probably benign Het
Adam26b A G 8: 43,521,338 V209A possibly damaging Het
Adh6a T A 3: 138,326,115 M256K probably benign Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Angptl2 G T 2: 33,243,883 D406Y probably damaging Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arfgef1 C T 1: 10,173,262 D1021N probably damaging Het
Arhgap17 G A 7: 123,286,618 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp13a4 A T 16: 29,452,603 D498E probably damaging Het
C4a T A 17: 34,810,131 noncoding transcript Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Camsap3 A C 8: 3,600,689 K223T possibly damaging Het
Cast A G 13: 74,746,014 S171P probably benign Het
Cdh8 T A 8: 99,024,859 D742V probably benign Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cers3 G A 7: 66,781,856 probably null Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Cntn5 C A 9: 9,704,912 K832N possibly damaging Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Ctf2 T C 7: 127,719,384 T148A probably benign Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Dhx36 A T 3: 62,500,998 L140M probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dlgap1 T A 17: 70,761,095 Y554N probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnah6 T C 6: 73,070,597 M3140V probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dyrk1a C T 16: 94,692,065 T719I probably benign Het
Erlin1 T A 19: 44,040,792 K234* probably null Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Frmd4b T C 6: 97,295,755 H846R probably benign Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm27047 T C 6: 130,630,516 noncoding transcript Het
Gm7168 A G 17: 13,949,807 R479G possibly damaging Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
H2-D1 T G 17: 35,266,516 probably null Het
Hpf1 T G 8: 60,893,730 S26R possibly damaging Het
Ift80 T A 3: 68,914,940 N627I probably benign Het
Inpp5d A G 1: 87,665,451 K91R probably benign Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Man1a2 A G 3: 100,632,561 L188P probably damaging Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl25 A T 10: 105,779,648 C498* probably null Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Mvp T A 7: 126,993,549 I397F probably damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Nudt5 G A 2: 5,856,065 probably benign Het
Nyap2 T A 1: 81,336,729 D713E probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Orc4 A T 2: 48,936,750 probably benign Het
Pde10a T A 17: 8,757,053 N3K possibly damaging Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Piwil4 G A 9: 14,712,308 R529* probably null Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prkg1 T C 19: 30,595,012 T400A probably damaging Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptcd1 A T 5: 145,155,175 H371Q probably benign Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rapgef5 G A 12: 117,714,128 G366E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,919 probably benign Het
Sfxn3 A G 19: 45,050,874 probably null Het
Sgce T C 6: 4,689,560 probably benign Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc18a1 A G 8: 69,043,931 M360T possibly damaging Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Tarsl2 T A 7: 65,689,969 V704E probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Txndc11 A G 16: 11,075,122 S915P probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vmn2r109 T A 17: 20,541,394 K567M probably damaging Het
Vmn2r23 T C 6: 123,741,730 F681L probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 splice site probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
R7643:Setd2 UTSW 9 110567840 splice site probably null
R7869:Setd2 UTSW 9 110550014 nonsense probably null
R7903:Setd2 UTSW 9 110617837 missense
R8004:Setd2 UTSW 9 110592545 missense
R8017:Setd2 UTSW 9 110602187 missense
R8019:Setd2 UTSW 9 110602187 missense
R8366:Setd2 UTSW 9 110548748 missense probably damaging 1.00
R8460:Setd2 UTSW 9 110594270 missense
RF009:Setd2 UTSW 9 110550711 missense probably damaging 1.00
Z1176:Setd2 UTSW 9 110532726 missense possibly damaging 0.85
Z1176:Setd2 UTSW 9 110547275 missense probably damaging 0.99
Z1176:Setd2 UTSW 9 110547579 missense probably damaging 0.97
Z1177:Setd2 UTSW 9 110547476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCATCTTTCCAGCTCC -3'
(R):5'- ACATAGGCTTGCATGGGGTAAC -3'

Sequencing Primer
(F):5'- GTGCTGGATGTTGAATTTAAGCAATC -3'
(R):5'- ATCCCCAAGTTCTGCATC -3'
Posted On2015-10-08