Incidental Mutation 'R4652:Vmn2r109'
ID 351437
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 041912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R4652 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20541394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 567 (K567M)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: K567M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: K567M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (111/117)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,639,611 Q131L probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
A830018L16Rik C A 1: 11,537,342 probably benign Het
Adam26b A G 8: 43,521,338 V209A possibly damaging Het
Adh6a T A 3: 138,326,115 M256K probably benign Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Angptl2 G T 2: 33,243,883 D406Y probably damaging Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arfgef1 C T 1: 10,173,262 D1021N probably damaging Het
Arhgap17 G A 7: 123,286,618 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp13a4 A T 16: 29,452,603 D498E probably damaging Het
C4a T A 17: 34,810,131 noncoding transcript Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Camsap3 A C 8: 3,600,689 K223T possibly damaging Het
Cast A G 13: 74,746,014 S171P probably benign Het
Cdh8 T A 8: 99,024,859 D742V probably benign Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cers3 G A 7: 66,781,856 probably null Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Cntn5 C A 9: 9,704,912 K832N possibly damaging Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Ctf2 T C 7: 127,719,384 T148A probably benign Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Dhx36 A T 3: 62,500,998 L140M probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dlgap1 T A 17: 70,761,095 Y554N probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnah6 T C 6: 73,070,597 M3140V probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dyrk1a C T 16: 94,692,065 T719I probably benign Het
Erlin1 T A 19: 44,040,792 K234* probably null Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Frmd4b T C 6: 97,295,755 H846R probably benign Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm27047 T C 6: 130,630,516 noncoding transcript Het
Gm7168 A G 17: 13,949,807 R479G possibly damaging Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
H2-D1 T G 17: 35,266,516 probably null Het
Hpf1 T G 8: 60,893,730 S26R possibly damaging Het
Ift80 T A 3: 68,914,940 N627I probably benign Het
Inpp5d A G 1: 87,665,451 K91R probably benign Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Man1a2 A G 3: 100,632,561 L188P probably damaging Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl25 A T 10: 105,779,648 C498* probably null Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Mvp T A 7: 126,993,549 I397F probably damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Nudt5 G A 2: 5,856,065 probably benign Het
Nyap2 T A 1: 81,336,729 D713E probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Orc4 A T 2: 48,936,750 probably benign Het
Pde10a T A 17: 8,757,053 N3K possibly damaging Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Piwil4 G A 9: 14,712,308 R529* probably null Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prkg1 T C 19: 30,595,012 T400A probably damaging Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptcd1 A T 5: 145,155,175 H371Q probably benign Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rapgef5 G A 12: 117,714,128 G366E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,919 probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sfxn3 A G 19: 45,050,874 probably null Het
Sgce T C 6: 4,689,560 probably benign Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc18a1 A G 8: 69,043,931 M360T possibly damaging Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Tarsl2 T A 7: 65,689,969 V704E probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Txndc11 A G 16: 11,075,122 S915P probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vmn2r23 T C 6: 123,741,730 F681L probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAATATGGTCTGCTGAAGGATG -3'
(R):5'- TCACTGTAAAACAACGAAGGTG -3'

Sequencing Primer
(F):5'- TGAGCAAAGTGTAACTGAGACCTC -3'
(R):5'- ACGAAGGTGAAATTTGTGATGTTCC -3'
Posted On 2015-10-08