Incidental Mutation 'R0269:Sytl2'
ID35144
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission 038495-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0269 (G1)
Quality Score179
Status Validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 90403020 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098310
SMART Domains Protein: ENSMUSP00000095912
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
low complexity region 938 966 N/A INTRINSIC
C2 990 1095 4.59e-15 SMART
C2 1139 1242 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107210
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107211
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190365
Predicted Effect probably benign
Transcript: ENSMUST00000190731
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190837
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209188
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.1%
  • 20x: 93.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,954,000 V231I possibly damaging Het
Abca1 T C 4: 53,044,228 D1798G probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Amhr2 T C 15: 102,447,068 C189R probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
AW551984 T C 9: 39,599,950 Y153C probably damaging Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Cd46 T G 1: 195,064,688 I339L probably benign Het
Cdkn2aip A G 8: 47,711,977 S234P probably damaging Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Csf2rb2 G T 15: 78,288,865 T265N probably benign Het
Cyp2c40 A G 19: 39,773,896 F436L probably damaging Het
D130040H23Rik T C 8: 69,300,794 F24S probably benign Het
Defb12 G T 8: 19,114,359 A34E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Gldc T A 19: 30,118,602 I670F probably damaging Het
Guf1 A C 5: 69,559,599 Q168P probably damaging Het
Hcn2 A G 10: 79,734,241 probably benign Het
Hddc2 A G 10: 31,327,946 M190V probably benign Het
Kcnq2 T C 2: 181,096,974 E294G probably benign Het
Kdelr1 T A 7: 45,874,039 probably benign Het
Kidins220 T A 12: 25,040,512 H1158Q probably damaging Het
Laptm5 A T 4: 130,930,816 N185Y probably benign Het
Mgat4a A G 1: 37,490,307 Y164H possibly damaging Het
Mlh3 C A 12: 85,268,405 V336L probably benign Het
Myadm A G 7: 3,296,757 T12A unknown Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr954 T C 9: 39,461,794 M118T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Recql5 T C 11: 115,928,224 D172G possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Rgs7 A G 1: 175,270,820 S58P possibly damaging Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Sgsm1 T C 5: 113,286,929 probably null Het
Slc22a19 A T 19: 7,709,621 probably benign Het
Slc6a21 T A 7: 45,286,908 Y428* probably null Het
Smarca4 T G 9: 21,636,201 M260R probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata17 T C 1: 187,097,872 I322V probably benign Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Sult1d1 A T 5: 87,564,802 I61N probably damaging Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Trmt11 T A 10: 30,587,489 H210L probably benign Het
Ush2a T A 1: 188,810,176 M3313K probably benign Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
R8127:Sytl2 UTSW 7 90375590 missense possibly damaging 0.93
R8171:Sytl2 UTSW 7 90409470 missense probably damaging 1.00
R8225:Sytl2 UTSW 7 90375517 missense probably benign 0.36
R8297:Sytl2 UTSW 7 90385075 missense probably benign
R8843:Sytl2 UTSW 7 90376126 missense probably benign 0.03
R8929:Sytl2 UTSW 7 90375602 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GTAGCTTGGATGCAGAGGGAAAACT -3'
(R):5'- TGTTCGCATGGTACAAACACCAAGAT -3'

Sequencing Primer
(F):5'- AAATGGGACAGATATGGCCC -3'
(R):5'- ggaagatggcaaaggggag -3'
Posted On2013-05-09