Incidental Mutation 'R4653:Adhfe1'
ID351446
Institutional Source Beutler Lab
Gene Symbol Adhfe1
Ensembl Gene ENSMUSG00000025911
Gene Namealcohol dehydrogenase, iron containing, 1
Synonyms6330565B14Rik
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location9547948-9580673 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 9550578 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably benign
Transcript: ENSMUST00000072079
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130927
AA Change: V39F
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Adhfe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Adhfe1 APN 1 9566863 missense probably benign
IGL01735:Adhfe1 APN 1 9548148 missense possibly damaging 0.90
IGL02862:Adhfe1 APN 1 9553811 missense probably damaging 1.00
IGL02891:Adhfe1 APN 1 9558171 missense probably benign
IGL03198:Adhfe1 APN 1 9549952 splice site probably benign
IGL03297:Adhfe1 APN 1 9549948 splice site probably benign
R0095:Adhfe1 UTSW 1 9560177 missense possibly damaging 0.79
R0180:Adhfe1 UTSW 1 9563857 missense probably benign 0.00
R0347:Adhfe1 UTSW 1 9553430 missense probably benign 0.00
R0590:Adhfe1 UTSW 1 9548153 critical splice donor site probably null
R1509:Adhfe1 UTSW 1 9553446 missense probably benign 0.03
R1606:Adhfe1 UTSW 1 9553473 critical splice donor site probably null
R1720:Adhfe1 UTSW 1 9566900 missense probably benign 0.01
R2048:Adhfe1 UTSW 1 9563553 missense probably benign 0.00
R3918:Adhfe1 UTSW 1 9576216 missense probably damaging 0.99
R4375:Adhfe1 UTSW 1 9561628 intron probably benign
R4576:Adhfe1 UTSW 1 9553754 missense probably damaging 1.00
R4724:Adhfe1 UTSW 1 9576250 missense probably damaging 0.99
R4760:Adhfe1 UTSW 1 9563523 missense probably damaging 0.97
R4859:Adhfe1 UTSW 1 9558213 missense probably damaging 1.00
R4967:Adhfe1 UTSW 1 9566804 missense probably benign 0.11
R4970:Adhfe1 UTSW 1 9558238 missense possibly damaging 0.92
R5087:Adhfe1 UTSW 1 9561626 intron probably benign
R6146:Adhfe1 UTSW 1 9553718 missense probably damaging 0.98
R7013:Adhfe1 UTSW 1 9550591 intron probably benign
R7084:Adhfe1 UTSW 1 9566805 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAATGTTTAGGTTCTTGAGGAGC -3'
(R):5'- GCTGAAAACAAAATTGTGCCTG -3'

Sequencing Primer
(F):5'- AGGAGCAAGTCTTTTGGGG -3'
(R):5'- TTTTTCCAGGGGCGAGATCCC -3'
Posted On2015-10-08