Incidental Mutation 'R4653:R3hdm1'
ID351447
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128184444 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 422 (S422P)
Ref Sequence ENSEMBL: ENSMUSP00000141142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000190056]
Predicted Effect probably benign
Transcript: ENSMUST00000036288
AA Change: S422P

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: S422P

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185471
Predicted Effect probably benign
Transcript: ENSMUST00000185853
Predicted Effect probably damaging
Transcript: ENSMUST00000187023
AA Change: S366P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211
AA Change: S366P

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187900
AA Change: S422P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211
AA Change: S422P

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190056
AA Change: S113P

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140209
Gene: ENSMUSG00000056211
AA Change: S113P

DomainStartEndE-ValueType
low complexity region 82 115 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 281 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191016
Meta Mutation Damage Score 0.1281 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
R7168:R3hdm1 UTSW 1 128216495 missense probably benign 0.05
R7210:R3hdm1 UTSW 1 128211208 missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128182211 splice site probably null
R7896:R3hdm1 UTSW 1 128168966 splice site probably null
R7979:R3hdm1 UTSW 1 128168966 splice site probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTAAAGAACCACTAGGCAG -3'
(R):5'- TTGATCAGAATACTGCCAGGTGG -3'

Sequencing Primer
(F):5'- GGCAGTAAATTATAGAAGCCATTGC -3'
(R):5'- AATACTGCCAGGTGGTATGCC -3'
Posted On2015-10-08