Mutagenetix > Incidental Mutation

Incidental Mutation 'R4653:Trmt1l'

351448

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

041913-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4653 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 151439569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 16 (V16I)

Ref Sequence

ENSEMBL: ENSMUSP00000140009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000065625
AA Change: V169I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: V169I

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188843

Predicted Effect

probably benign
Transcript: ENSMUST00000189655
AA Change: V16I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286
AA Change: V16I

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198467

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,430	T351A	probably benign	Het
3930402G23Rik	A	T	8: 10,926,075		noncoding transcript	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Abca4	G	T	3: 122,138,581	E295*	probably null	Het
Abi3	T	C	11: 95,832,811	I215V	probably benign	Het
Adhfe1	G	T	1: 9,550,578		probably benign	Het
Akr1a1	A	G	4: 116,637,959		probably benign	Het
Ank	T	A	15: 27,590,361	W344R	probably null	Het
Cast	A	G	13: 74,746,014	S171P	probably benign	Het
Ccdc39	A	G	3: 33,819,806		probably null	Het
Cd180	T	A	13: 102,704,908	L154H	probably damaging	Het
Cnp	A	T	11: 100,576,516	D95V	probably benign	Het
Cul1	T	C	6: 47,484,963	I20T	probably damaging	Het
Dnah6	T	C	6: 73,073,457	K3042R	possibly damaging	Het
Dpy19l1	A	C	9: 24,482,054	S140A	possibly damaging	Het
Dpys	C	A	15: 39,793,246	R475L	probably damaging	Het
Dync1i2	A	G	2: 71,247,855	N276S	probably damaging	Het
Ext2	T	C	2: 93,696,159	S711G	probably benign	Het
Fam71e2	T	C	7: 4,758,055	R553G	possibly damaging	Het
Fancm	A	G	12: 65,083,054	Y223C	probably damaging	Het
Folh1	C	A	7: 86,744,425	G360*	probably null	Het
Gcat	T	C	15: 79,035,287	S151P	probably damaging	Het
Gcm2	A	T	13: 41,102,841	D477E	probably benign	Het
Git1	A	G	11: 77,505,043	N468S	possibly damaging	Het
Gtf3c1	T	C	7: 125,674,100	I622V	probably benign	Het
Hsd17b13	G	A	5: 103,965,836	L251F	probably damaging	Het
Lamc1	T	G	1: 153,228,777	S59R	probably damaging	Het
Llgl1	A	G	11: 60,708,651	D486G	possibly damaging	Het
Lrrk1	T	C	7: 66,273,053	I1366V	probably benign	Het
Ly9	G	T	1: 171,594,029	H441Q	probably benign	Het
Myo15b	G	A	11: 115,879,987		probably null	Het
Nomo1	G	T	7: 46,061,813	A639S	probably benign	Het
P3h2	T	C	16: 26,105,277	D136G	probably damaging	Het
Pde4dip	A	T	3: 97,767,338	D87E	probably damaging	Het
Pdpk1	A	T	17: 24,106,897	D108E	probably benign	Het
Pex26	C	T	6: 121,190,125	S231L	probably damaging	Het
Prpf38b	G	A	3: 108,904,092		probably benign	Het
Prpf4b	A	T	13: 34,899,971	M908L	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
R3hdm1	T	C	1: 128,184,444	S422P	probably damaging	Het
Rhox2a	G	C	X: 37,245,309	R43P	probably benign	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Ryr3	T	A	2: 112,652,763	N4213I	probably damaging	Het
Slc7a14	A	G	3: 31,257,682	V63A	probably damaging	Het
Soga1	A	G	2: 157,040,591	F514L	probably damaging	Het
Sppl2a	C	T	2: 126,920,313		probably null	Het
Sspo	T	A	6: 48,478,646	W3077R	probably damaging	Het
Stag1	T	A	9: 100,796,716	M230K	probably damaging	Het
Sv2a	T	C	3: 96,190,762		probably null	Het
Themis2	A	G	4: 132,782,976	S638P	probably benign	Het
Trabd	A	G	15: 89,085,839	Y346C	probably damaging	Het
Trim38	A	T	13: 23,782,969	D133V	probably damaging	Het
Ube2b	A	G	11: 51,995,372		probably null	Het
Usp13	A	T	3: 32,837,924	Q84L	probably damaging	Het
Vmn1r172	G	T	7: 23,660,572	G294V	probably damaging	Het
Vmn2r59	A	T	7: 42,043,804	H457Q	probably benign	Het
Vmn2r63	A	G	7: 42,903,690	I714T	possibly damaging	Het
Vps8	T	C	16: 21,500,210	Y602H	probably damaging	Het
Zbp1	G	A	2: 173,207,815	P385S	possibly damaging	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GCCATCTCAAATAGAACAATAATCCT -3'
(R):5'- ATTGGAAAGCACTGAGGTGAGT -3'

Sequencing Primer
(F):5'- ATGTAGATCAAGCTGGCCTC -3'
(R):5'- TCATTTCAGCACTCGGGAAG -3'

Posted On

2015-10-08