Incidental Mutation 'R4653:Slc7a14'
ID 351458
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock # R4653 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 31202858-31310378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31257682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 63 (V63A)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: V63A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: V63A

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: V63A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: V63A

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Meta Mutation Damage Score 0.1025 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
R9011:Slc7a14 UTSW 3 31224196 missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31227210 missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31224017 missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCACTTAGGGCAGTGAATAACC -3'
(R):5'- TCTATCTATCAGCAAACCTTCACTG -3'

Sequencing Primer
(F):5'- GTGAATAACCTTGCTGTGAGACCC -3'
(R):5'- CCCTACTGTTAAAGATGAGTGGC -3'
Posted On 2015-10-08