Incidental Mutation 'R4653:Akr1a1'
ID351463
Institutional Source Beutler Lab
Gene Symbol Akr1a1
Ensembl Gene ENSMUSG00000028692
Gene Namealdo-keto reductase family 1, member A1 (aldehyde reductase)
SynonymsAkr1a4, 2610201A18Rik
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116636510-116651680 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 116637959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030455] [ENSMUST00000128059]
Predicted Effect probably benign
Transcript: ENSMUST00000030455
SMART Domains Protein: ENSMUSP00000030455
Gene: ENSMUSG00000028692

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 294 1.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128010
Predicted Effect probably benign
Transcript: ENSMUST00000128059
SMART Domains Protein: ENSMUSP00000114861
Gene: ENSMUSG00000028692

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 204 3.7e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased osteoporosis in response to pregnancy or castration in the absence of dietary ascorbate. Mice homozygous for a knock-out allele exhibit reduced asorbic acid levels and DL-glyceraldehyde, glucuronolactone and glucuronate reductase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Akr1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Akr1a1 APN 4 116637983 missense probably damaging 1.00
IGL03176:Akr1a1 APN 4 116639075 missense probably damaging 1.00
IGL03265:Akr1a1 APN 4 116637817 missense probably benign 0.42
R0480:Akr1a1 UTSW 4 116639847 missense possibly damaging 0.84
R0972:Akr1a1 UTSW 4 116640007 critical splice acceptor site probably null
R1649:Akr1a1 UTSW 4 116638020 missense probably damaging 1.00
R1711:Akr1a1 UTSW 4 116637974 critical splice donor site probably null
R1727:Akr1a1 UTSW 4 116641051 missense probably damaging 1.00
R1822:Akr1a1 UTSW 4 116636653 missense probably benign 0.13
R5377:Akr1a1 UTSW 4 116639895 missense probably damaging 1.00
R7386:Akr1a1 UTSW 4 116641054 missense probably damaging 0.98
R7458:Akr1a1 UTSW 4 116637817 missense possibly damaging 0.61
R8253:Akr1a1 UTSW 4 116636643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTACCGTAATCATGGGCAC -3'
(R):5'- TACCATGGGTCATCTTGCCTAG -3'

Sequencing Primer
(F):5'- GGGCACAATATACCGCCAATTTTTG -3'
(R):5'- TTGCCTAGTCCTCTGAGGCG -3'
Posted On2015-10-08