Incidental Mutation 'R4653:Vmn2r59'
ID351472
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42043804 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 457 (H457Q)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121359
Predicted Effect probably benign
Transcript: ENSMUST00000168489
AA Change: H457Q

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: H457Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4703:Vmn2r59 UTSW 7 42012262 missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 42043753 missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 42043747 missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 42045809 missense probably damaging 1.00
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAGAAGTCACACCTCACCTTTG -3'
(R):5'- TCTTTGCTGGAACTGTGACAAAC -3'

Sequencing Primer
(F):5'- TGTAAACCCTGTAGGCCACTG -3'
(R):5'- TGTGACAAACAGCTGTCCTG -3'
Posted On2015-10-08