Incidental Mutation 'R4653:Dpy19l1'
ID351481
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Namedpy-19-like 1 (C. elegans)
Synonyms1100001I19Rik
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24411776-24503140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24482054 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 140 (S140A)
Ref Sequence ENSEMBL: ENSMUSP00000129575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
Predicted Effect probably benign
Transcript: ENSMUST00000115277
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129048
Predicted Effect possibly damaging
Transcript: ENSMUST00000142064
AA Change: S140A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: S140A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170356
AA Change: S140A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: S140A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24481930 missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24462568 splice site probably benign
IGL00959:Dpy19l1 APN 9 24423197 splice site probably null
IGL01646:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24475386 missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24438713 splice site probably benign
IGL02677:Dpy19l1 APN 9 24485072 missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24421180 missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24438660 missense probably benign 0.00
R0066:Dpy19l1 UTSW 9 24414409 missense possibly damaging 0.95
R0207:Dpy19l1 UTSW 9 24453891 missense probably damaging 1.00
R0462:Dpy19l1 UTSW 9 24414349 missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24485110 splice site probably benign
R0749:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R0838:Dpy19l1 UTSW 9 24432431 missense probably damaging 0.98
R1114:Dpy19l1 UTSW 9 24424776 missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24475384 missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24473824 missense probably benign
R1933:Dpy19l1 UTSW 9 24434387 missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24423159 missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24482035 missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24485048 missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24432388 missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24432368 missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24450670 missense probably benign 0.29
R4769:Dpy19l1 UTSW 9 24426148 missense probably damaging 0.99
R4785:Dpy19l1 UTSW 9 24424823 missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24438628 critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24414388 missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24414267 makesense probably null
R6265:Dpy19l1 UTSW 9 24432371 missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24439146 missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24462600 missense probably damaging 1.00
R6380:Dpy19l1 UTSW 9 24482045 nonsense probably null
R6478:Dpy19l1 UTSW 9 24450696 missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24447864 missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24473784 missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24440772 missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24423123 missense possibly damaging 0.88
X0025:Dpy19l1 UTSW 9 24432380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATCACAATTATAGATCCCAGAG -3'
(R):5'- ACTCTTCATACATGGCAAATGCAG -3'

Sequencing Primer
(F):5'- TATAGATCCCAGAGATTCAAAATCCC -3'
(R):5'- CATACATGGCAAATGCAGAATTG -3'
Posted On2015-10-08