Incidental Mutation 'R4653:Abi3'
ID 351486
Institutional Source Beutler Lab
Gene Symbol Abi3
Ensembl Gene ENSMUSG00000018381
Gene Name ABI gene family, member 3
Synonyms
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4653 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 95830074-95842476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95832811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 215 (I215V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000107712] [ENSMUST00000133070] [ENSMUST00000150134]
AlphaFold Q8BYZ1
Predicted Effect probably benign
Transcript: ENSMUST00000054173
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000059026
AA Change: I336V
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381
AA Change: I336V

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107712
SMART Domains Protein: ENSMUSP00000103340
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137645
AA Change: I215V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381
AA Change: I215V

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143492
Predicted Effect probably benign
Transcript: ENSMUST00000150134
Predicted Effect probably benign
Transcript: ENSMUST00000176538
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Abi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Abi3 APN 11 95835799 missense probably damaging 1.00
R0045:Abi3 UTSW 11 95832715 makesense probably null
R0626:Abi3 UTSW 11 95837111 missense probably benign 0.28
R0690:Abi3 UTSW 11 95833634 unclassified probably benign
R5358:Abi3 UTSW 11 95842108 missense probably benign 0.21
R5881:Abi3 UTSW 11 95834387 missense probably damaging 1.00
R5881:Abi3 UTSW 11 95834388 missense probably damaging 1.00
R6020:Abi3 UTSW 11 95842025 nonsense probably null
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6130:Abi3 UTSW 11 95837095 missense probably damaging 1.00
R6388:Abi3 UTSW 11 95833638 critical splice donor site probably null
R6963:Abi3 UTSW 11 95832741 unclassified probably benign
R7867:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
R7922:Abi3 UTSW 11 95832793 missense unknown
R9641:Abi3 UTSW 11 95833677 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCACAGCCCAAGAGGTAGAC -3'
(R):5'- ACCTGACTGTTCCAAAGCC -3'

Sequencing Primer
(F):5'- TAGACAGGTCCTTAGTCCAGC -3'
(R):5'- GTTCCAAAGCCCCTCTACG -3'
Posted On 2015-10-08