Incidental Mutation 'R4653:Cnp'
ID351487
Institutional Source Beutler Lab
Gene Symbol Cnp
Ensembl Gene ENSMUSG00000006782
Gene Name2',3'-cyclic nucleotide 3' phosphodiesterase
SynonymsCNPase, Cnp-1, Cnp1
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100574904-100591729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100576516 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 95 (D95V)
Ref Sequence ENSEMBL: ENSMUSP00000099409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684] [ENSMUST00000103120]
PDB Structure
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with sulfate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic NADP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with GTP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic AMP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3-(SP)-Cyclic-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3'- cyclic AMP [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000006976
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092684
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103120
AA Change: D95V

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782
AA Change: D95V

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150414
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in ataxia, gait abnormalities, hindlimb paralysis, muscle weakness, convulsive seizures, weight loss, kyphosis, reactive gliosis, axonal swellings and degeneration, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Cnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Cnp APN 11 100576699 missense probably benign 0.25
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0015:Cnp UTSW 11 100578908 splice site probably null
R0015:Cnp UTSW 11 100578908 splice site probably null
R0546:Cnp UTSW 11 100580723 missense probably damaging 1.00
R2384:Cnp UTSW 11 100576453 missense probably damaging 1.00
R4654:Cnp UTSW 11 100579051 missense possibly damaging 0.90
R4898:Cnp UTSW 11 100576376 missense probably benign 0.11
R5559:Cnp UTSW 11 100576417 missense probably damaging 1.00
R7045:Cnp UTSW 11 100580358 missense probably benign 0.00
R7225:Cnp UTSW 11 100580587 nonsense probably null
R7776:Cnp UTSW 11 100578988 missense probably damaging 1.00
R8350:Cnp UTSW 11 100576441 missense probably damaging 1.00
R8450:Cnp UTSW 11 100576441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCTTCAAGATGAGGACAC -3'
(R):5'- ACAGCTGCCATTGGTTCTTC -3'

Sequencing Primer
(F):5'- ATGAGGACACGGTGGCTACC -3'
(R):5'- CTTGAGCTGGGCACAGTCTAGTC -3'
Posted On2015-10-08