Mutagenetix > Incidental Mutation

Incidental Mutation 'R4653:P3h2'

351499

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

041913-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4653 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26105277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 136 (D136G)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

probably damaging
Transcript: ENSMUST00000039990
AA Change: D136G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: D136G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Meta Mutation Damage Score

0.1332

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,430	T351A	probably benign	Het
3930402G23Rik	A	T	8: 10,926,075		noncoding transcript	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Abca4	G	T	3: 122,138,581	E295*	probably null	Het
Abi3	T	C	11: 95,832,811	I215V	probably benign	Het
Adhfe1	G	T	1: 9,550,578		probably benign	Het
Akr1a1	A	G	4: 116,637,959		probably benign	Het
Ank	T	A	15: 27,590,361	W344R	probably null	Het
Cast	A	G	13: 74,746,014	S171P	probably benign	Het
Ccdc39	A	G	3: 33,819,806		probably null	Het
Cd180	T	A	13: 102,704,908	L154H	probably damaging	Het
Cnp	A	T	11: 100,576,516	D95V	probably benign	Het
Cul1	T	C	6: 47,484,963	I20T	probably damaging	Het
Dnah6	T	C	6: 73,073,457	K3042R	possibly damaging	Het
Dpy19l1	A	C	9: 24,482,054	S140A	possibly damaging	Het
Dpys	C	A	15: 39,793,246	R475L	probably damaging	Het
Dync1i2	A	G	2: 71,247,855	N276S	probably damaging	Het
Ext2	T	C	2: 93,696,159	S711G	probably benign	Het
Fam71e2	T	C	7: 4,758,055	R553G	possibly damaging	Het
Fancm	A	G	12: 65,083,054	Y223C	probably damaging	Het
Folh1	C	A	7: 86,744,425	G360*	probably null	Het
Gcat	T	C	15: 79,035,287	S151P	probably damaging	Het
Gcm2	A	T	13: 41,102,841	D477E	probably benign	Het
Git1	A	G	11: 77,505,043	N468S	possibly damaging	Het
Gtf3c1	T	C	7: 125,674,100	I622V	probably benign	Het
Hsd17b13	G	A	5: 103,965,836	L251F	probably damaging	Het
Lamc1	T	G	1: 153,228,777	S59R	probably damaging	Het
Llgl1	A	G	11: 60,708,651	D486G	possibly damaging	Het
Lrrk1	T	C	7: 66,273,053	I1366V	probably benign	Het
Ly9	G	T	1: 171,594,029	H441Q	probably benign	Het
Myo15b	G	A	11: 115,879,987		probably null	Het
Nomo1	G	T	7: 46,061,813	A639S	probably benign	Het
Pde4dip	A	T	3: 97,767,338	D87E	probably damaging	Het
Pdpk1	A	T	17: 24,106,897	D108E	probably benign	Het
Pex26	C	T	6: 121,190,125	S231L	probably damaging	Het
Prpf38b	G	A	3: 108,904,092		probably benign	Het
Prpf4b	A	T	13: 34,899,971	M908L	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
R3hdm1	T	C	1: 128,184,444	S422P	probably damaging	Het
Rhox2a	G	C	X: 37,245,309	R43P	probably benign	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Ryr3	T	A	2: 112,652,763	N4213I	probably damaging	Het
Slc7a14	A	G	3: 31,257,682	V63A	probably damaging	Het
Soga1	A	G	2: 157,040,591	F514L	probably damaging	Het
Sppl2a	C	T	2: 126,920,313		probably null	Het
Sspo	T	A	6: 48,478,646	W3077R	probably damaging	Het
Stag1	T	A	9: 100,796,716	M230K	probably damaging	Het
Sv2a	T	C	3: 96,190,762		probably null	Het
Themis2	A	G	4: 132,782,976	S638P	probably benign	Het
Trabd	A	G	15: 89,085,839	Y346C	probably damaging	Het
Trim38	A	T	13: 23,782,969	D133V	probably damaging	Het
Trmt1l	G	A	1: 151,439,569	V16I	probably benign	Het
Ube2b	A	G	11: 51,995,372		probably null	Het
Usp13	A	T	3: 32,837,924	Q84L	probably damaging	Het
Vmn1r172	G	T	7: 23,660,572	G294V	probably damaging	Het
Vmn2r59	A	T	7: 42,043,804	H457Q	probably benign	Het
Vmn2r63	A	G	7: 42,903,690	I714T	possibly damaging	Het
Vps8	T	C	16: 21,500,210	Y602H	probably damaging	Het
Zbp1	G	A	2: 173,207,815	P385S	possibly damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCACGCAAAGCAGAG -3'
(R):5'- CTACTACAGCGGCGACTATG -3'

Sequencing Primer
(F):5'- AGCCACTGCGAAAGGCTG -3'
(R):5'- ACTATGAGCGAGCGGTGC -3'

Posted On

2015-10-08