Incidental Mutation 'R4653:Pdpk1'
ID351500
Institutional Source Beutler Lab
Gene Symbol Pdpk1
Ensembl Gene ENSMUSG00000024122
Gene Name3-phosphoinositide dependent protein kinase 1
SynonymsPkb kinase, Pdk1
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24073680-24150924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24106897 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 108 (D108E)
Ref Sequence ENSEMBL: ENSMUSP00000121771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052462] [ENSMUST00000102927] [ENSMUST00000115407] [ENSMUST00000115409] [ENSMUST00000115411] [ENSMUST00000128997] [ENSMUST00000144533] [ENSMUST00000154982]
Predicted Effect probably benign
Transcript: ENSMUST00000052462
AA Change: D108E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122
AA Change: D108E

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102927
AA Change: D135E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115407
AA Change: D135E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115411
AA Change: D135E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140906
Predicted Effect probably benign
Transcript: ENSMUST00000144533
AA Change: D108E

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122
AA Change: D108E

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150578
Predicted Effect probably benign
Transcript: ENSMUST00000154982
AA Change: D108E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122
AA Change: D108E

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit embryogenesis defects, impaired forebrain development, and die by mid gestation. Cardiac muscle-specific conditional mutants exhibit thin ventricular walls and die of heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Gtf3c1 T C 7: 125,674,100 I622V probably benign Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Pdpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdpk1 APN 17 24106861 missense possibly damaging 0.87
IGL01467:Pdpk1 APN 17 24088170 missense probably damaging 0.98
IGL02251:Pdpk1 APN 17 24079638 missense probably damaging 1.00
IGL03411:Pdpk1 APN 17 24101644 missense probably damaging 1.00
R0152:Pdpk1 UTSW 17 24106946 missense possibly damaging 0.93
R0610:Pdpk1 UTSW 17 24098171 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1817:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1819:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1822:Pdpk1 UTSW 17 24098176 splice site probably benign
R1823:Pdpk1 UTSW 17 24098176 splice site probably benign
R3783:Pdpk1 UTSW 17 24110850 missense possibly damaging 0.95
R5000:Pdpk1 UTSW 17 24111045 missense possibly damaging 0.66
R5385:Pdpk1 UTSW 17 24098140 nonsense probably null
R5425:Pdpk1 UTSW 17 24098121 missense probably damaging 1.00
R5429:Pdpk1 UTSW 17 24091560 missense probably benign 0.01
R5642:Pdpk1 UTSW 17 24106855 nonsense probably null
R5936:Pdpk1 UTSW 17 24093229 missense probably damaging 1.00
R6049:Pdpk1 UTSW 17 24098135 nonsense probably null
R6332:Pdpk1 UTSW 17 24106922 missense probably damaging 0.99
R6693:Pdpk1 UTSW 17 24111126 splice site probably null
R7423:Pdpk1 UTSW 17 24110900 missense probably benign 0.08
R7432:Pdpk1 UTSW 17 24101669 missense probably benign 0.43
R8279:Pdpk1 UTSW 17 24088173 missense probably benign
RF016:Pdpk1 UTSW 17 24093281 missense probably benign 0.01
Z1177:Pdpk1 UTSW 17 24088013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCCAAGGAGATCAGTACAC -3'
(R):5'- TCAAACCTTCTAACCGTGGGTG -3'

Sequencing Primer
(F):5'- CAGAGATCTGTGCTGTGCC -3'
(R):5'- CTTCTAACCGTGGGTGGGTGG -3'
Posted On2015-10-08