Incidental Mutation 'R4654:AI314180'
ID351524
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58834523 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 785 (I785N)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102889
AA Change: I785N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: I785N

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107557
AA Change: I785N

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: I785N

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142102
Predicted Effect possibly damaging
Transcript: ENSMUST00000149301
AA Change: I785N

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: I785N

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151869
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
R8326:AI314180 UTSW 4 58847093 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTTTCCCCATAAGTGGC -3'
(R):5'- AAGAAACAGTGCTGTCACATTG -3'

Sequencing Primer
(F):5'- AGTGGCACCAAAATATAAAAACATG -3'
(R):5'- CTGTCACATTGTTAAATTCAGAGCCC -3'
Posted On2015-10-08