Incidental Mutation 'R4654:Dennd5b'
ID 351539
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 041914-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R4654 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148908335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 986 (N986S)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: N986S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: N986S

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117470
Meta Mutation Damage Score 0.4750 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 25,193,819 (GRCm39) C398S probably damaging Het
Adamts10 A G 17: 33,756,304 (GRCm39) K316E possibly damaging Het
Ap1m1 T C 8: 73,006,717 (GRCm39) F238L possibly damaging Het
Aph1a T A 3: 95,803,088 (GRCm39) D180E probably benign Het
Atp9b A G 18: 80,935,093 (GRCm39) F201L probably benign Het
Btbd9 A C 17: 30,704,561 (GRCm39) probably benign Het
C2cd5 T C 6: 142,975,910 (GRCm39) T768A probably benign Het
Casq1 C T 1: 172,037,965 (GRCm39) probably benign Het
Cimap2 C A 4: 106,467,612 (GRCm39) M341I probably benign Het
Cltc A T 11: 86,617,196 (GRCm39) M351K probably benign Het
Cnp A G 11: 100,469,877 (GRCm39) E271G possibly damaging Het
Col22a1 T C 15: 71,845,544 (GRCm39) D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 (GRCm39) S117P probably benign Het
Cyp2b13 T C 7: 25,761,072 (GRCm39) L43P probably damaging Het
Cyp3a16 A G 5: 145,373,267 (GRCm39) V500A probably benign Het
Dclk2 T C 3: 86,743,683 (GRCm39) D262G probably damaging Het
Dcun1d3 A C 7: 119,458,742 (GRCm39) Y98D probably damaging Het
Ddx39b A G 17: 35,472,464 (GRCm39) *429W probably null Het
Dipk1a T C 5: 108,057,982 (GRCm39) probably null Het
Dusp9 G A X: 72,684,378 (GRCm39) R182Q probably benign Het
Ecpas A T 4: 58,834,523 (GRCm39) I785N possibly damaging Het
Edil3 A G 13: 89,437,589 (GRCm39) K397E probably damaging Het
Ehd1 T C 19: 6,326,994 (GRCm39) probably benign Het
Fam13a A T 6: 58,964,152 (GRCm39) H93Q probably benign Het
Farp1 T C 14: 121,513,716 (GRCm39) I837T possibly damaging Het
Fbxl5 T A 5: 43,922,771 (GRCm39) I216F probably damaging Het
Gadl1 G A 9: 115,770,408 (GRCm39) E74K probably damaging Het
Gnpnat1 A G 14: 45,618,436 (GRCm39) V122A probably damaging Het
Hdac10 C T 15: 89,011,036 (GRCm39) probably benign Het
Heatr5b T C 17: 79,128,130 (GRCm39) S502G possibly damaging Het
Hr C A 14: 70,801,013 (GRCm39) A695E probably damaging Het
Ift80 A T 3: 68,825,870 (GRCm39) I490N possibly damaging Het
Ipo11 A G 13: 106,970,692 (GRCm39) probably benign Het
Iqch T G 9: 63,432,195 (GRCm39) Y400S probably damaging Het
Jag2 C T 12: 112,877,266 (GRCm39) D702N probably benign Het
Kiss1r T A 10: 79,757,624 (GRCm39) L326Q probably damaging Het
Lrrc42 A T 4: 107,104,746 (GRCm39) I73N probably damaging Het
Lrrc55 C T 2: 85,026,880 (GRCm39) G48D possibly damaging Het
Lrrk2 T C 15: 91,649,884 (GRCm39) S1674P probably damaging Het
Mctp2 A G 7: 71,739,942 (GRCm39) L816P probably damaging Het
Mipol1 A T 12: 57,352,918 (GRCm39) T86S probably benign Het
Mkrn3 C T 7: 62,069,452 (GRCm39) R113H probably damaging Het
Mmp1b A G 9: 7,370,849 (GRCm39) V302A probably benign Het
Msc A T 1: 14,826,053 (GRCm39) probably null Het
Msmo1 C A 8: 65,180,888 (GRCm39) V9L probably benign Het
Nbeal2 G A 9: 110,461,072 (GRCm39) R1630C probably damaging Het
Nlgn1 C T 3: 26,187,850 (GRCm39) V12I possibly damaging Het
Npas3 T C 12: 54,108,915 (GRCm39) probably null Het
Nr2e3 A G 9: 59,856,355 (GRCm39) probably benign Het
Oca2 C T 7: 55,978,560 (GRCm39) A576V probably benign Het
Or5b21 T A 19: 12,839,596 (GRCm39) C152* probably null Het
Or6d12 T C 6: 116,493,409 (GRCm39) Y224H probably damaging Het
Or6z7 T C 7: 6,484,045 (GRCm39) T37A probably benign Het
Parp6 A G 9: 59,548,383 (GRCm39) probably null Het
Pate13 T A 9: 35,820,287 (GRCm39) C4S probably damaging Het
Phlpp1 A T 1: 106,267,231 (GRCm39) M715L probably benign Het
Pi4k2a G A 19: 42,101,544 (GRCm39) probably null Het
Pik3ap1 A G 19: 41,316,348 (GRCm39) S305P probably damaging Het
Plcg2 G A 8: 118,231,054 (GRCm39) M45I probably benign Het
Ppm1m A T 9: 106,073,601 (GRCm39) L317H probably damaging Het
Ppp1r21 T G 17: 88,866,227 (GRCm39) M341R probably benign Het
Prdx3 A G 19: 60,853,674 (GRCm39) V217A possibly damaging Het
Ptk2b A G 14: 66,400,496 (GRCm39) V773A possibly damaging Het
Raly T C 2: 154,699,376 (GRCm39) V60A probably damaging Het
Reps1 A G 10: 17,990,148 (GRCm39) D420G probably damaging Het
Rev1 A T 1: 38,118,337 (GRCm39) probably benign Het
Rgs2 T G 1: 143,878,650 (GRCm39) probably benign Het
Rlf G T 4: 121,007,798 (GRCm39) T394K probably benign Het
Rptn A T 3: 93,304,792 (GRCm39) R708S possibly damaging Het
Sec23b T A 2: 144,414,494 (GRCm39) M402K probably benign Het
Skic2 A G 17: 35,068,922 (GRCm39) C26R probably damaging Het
Slx9 T C 10: 77,325,860 (GRCm39) M170V possibly damaging Het
Smpd4 A G 16: 17,459,992 (GRCm39) probably benign Het
Synj2 A G 17: 6,063,813 (GRCm39) E434G probably damaging Het
Tatdn2 T A 6: 113,684,326 (GRCm39) F64I probably benign Het
Tex21 A C 12: 76,263,860 (GRCm39) H177Q probably benign Het
Tln1 T A 4: 43,535,954 (GRCm39) Q2077L probably null Het
Tnrc6c T C 11: 117,611,797 (GRCm39) V145A probably benign Het
Ttn C T 2: 76,616,936 (GRCm39) probably benign Het
Uggt2 A G 14: 119,269,670 (GRCm39) F954S possibly damaging Het
Ugt2a1 A G 5: 87,634,083 (GRCm39) S175P probably damaging Het
Vcl A G 14: 21,035,820 (GRCm39) probably null Het
Vegfa A T 17: 46,336,176 (GRCm39) probably benign Het
Vmn2r68 G A 7: 84,882,769 (GRCm39) Q328* probably null Het
Vmn2r7 A G 3: 64,626,864 (GRCm39) Y142H probably benign Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Ybx3 G T 6: 131,347,290 (GRCm39) R282S probably damaging Het
Zfp566 T C 7: 29,777,194 (GRCm39) H329R probably damaging Het
Zfp786 T C 6: 47,797,868 (GRCm39) I357V probably benign Het
Zfr2 C A 10: 81,087,083 (GRCm39) probably null Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTCAAGAGGCAGTGGG -3'
(R):5'- CTCATTGTATGAAGGTCCCCTGAG -3'

Sequencing Primer
(F):5'- GTCCGTTTACTCACCTGTA -3'
(R):5'- GGTCCCCTGAGAGCAAAGAC -3'
Posted On 2015-10-08