Incidental Mutation 'R0269:Olfr313'
ID35155
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
MMRRC Submission 038495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0269 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58817149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000150529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220] [ENSMUST00000217506]
Predicted Effect probably damaging
Transcript: ENSMUST00000082220
AA Change: V47A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: V47A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217506
AA Change: V47A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.1%
  • 20x: 93.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,954,000 V231I possibly damaging Het
Abca1 T C 4: 53,044,228 D1798G probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Amhr2 T C 15: 102,447,068 C189R probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
AW551984 T C 9: 39,599,950 Y153C probably damaging Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Cd46 T G 1: 195,064,688 I339L probably benign Het
Cdkn2aip A G 8: 47,711,977 S234P probably damaging Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Csf2rb2 G T 15: 78,288,865 T265N probably benign Het
Cyp2c40 A G 19: 39,773,896 F436L probably damaging Het
D130040H23Rik T C 8: 69,300,794 F24S probably benign Het
Defb12 G T 8: 19,114,359 A34E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Gldc T A 19: 30,118,602 I670F probably damaging Het
Guf1 A C 5: 69,559,599 Q168P probably damaging Het
Hcn2 A G 10: 79,734,241 probably benign Het
Hddc2 A G 10: 31,327,946 M190V probably benign Het
Kcnq2 T C 2: 181,096,974 E294G probably benign Het
Kdelr1 T A 7: 45,874,039 probably benign Het
Kidins220 T A 12: 25,040,512 H1158Q probably damaging Het
Laptm5 A T 4: 130,930,816 N185Y probably benign Het
Mgat4a A G 1: 37,490,307 Y164H possibly damaging Het
Mlh3 C A 12: 85,268,405 V336L probably benign Het
Myadm A G 7: 3,296,757 T12A unknown Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr954 T C 9: 39,461,794 M118T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Recql5 T C 11: 115,928,224 D172G possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Rgs7 A G 1: 175,270,820 S58P possibly damaging Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Sgsm1 T C 5: 113,286,929 probably null Het
Slc22a19 A T 19: 7,709,621 probably benign Het
Slc6a21 T A 7: 45,286,908 Y428* probably null Het
Smarca4 T G 9: 21,636,201 M260R probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata17 T C 1: 187,097,872 I322V probably benign Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Sult1d1 A T 5: 87,564,802 I61N probably damaging Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Trmt11 T A 10: 30,587,489 H210L probably benign Het
Ush2a T A 1: 188,810,176 M3313K probably benign Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
LCD18:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R2917:Olfr313 UTSW 11 58817488 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4245:Olfr313 UTSW 11 58817778 missense probably damaging 1.00
R4991:Olfr313 UTSW 11 58817718 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
R7553:Olfr313 UTSW 11 58817060 missense probably benign 0.10
R8204:Olfr313 UTSW 11 58817059 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCATCTGAGCACAATCTGAGCAGAC -3'
(R):5'- ATGAAAGGCTGAGTAGATGGCCCC -3'

Sequencing Primer
(F):5'- CATGTCCAATCACACAAGAGTG -3'
(R):5'- GCTCATGATGGTTCCATAGATCAG -3'
Posted On2013-05-09