Incidental Mutation 'R4654:Gnpnat1'
ID 351571
Institutional Source Beutler Lab
Gene Symbol Gnpnat1
Ensembl Gene ENSMUSG00000037722
Gene Name glucosamine-phosphate N-acetyltransferase 1
Synonyms EMeg32
MMRRC Submission 041914-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4654 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 45613897-45626972 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45618436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000154084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046191] [ENSMUST00000226276] [ENSMUST00000226590] [ENSMUST00000226785] [ENSMUST00000226856] [ENSMUST00000226873] [ENSMUST00000227468] [ENSMUST00000228003] [ENSMUST00000228304] [ENSMUST00000227865] [ENSMUST00000228311]
AlphaFold Q9JK38
Predicted Effect probably damaging
Transcript: ENSMUST00000046191
AA Change: V122A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042860
Gene: ENSMUSG00000037722
AA Change: V122A

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 82 172 8e-9 PFAM
Pfam:Acetyltransf_1 91 171 6.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226276
AA Change: V144A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000226590
Predicted Effect probably benign
Transcript: ENSMUST00000226785
Predicted Effect probably benign
Transcript: ENSMUST00000226856
Predicted Effect probably benign
Transcript: ENSMUST00000226873
Predicted Effect probably damaging
Transcript: ENSMUST00000227468
AA Change: V122A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000228451
AA Change: V72A
Predicted Effect probably benign
Transcript: ENSMUST00000228003
Predicted Effect probably benign
Transcript: ENSMUST00000228304
Predicted Effect probably benign
Transcript: ENSMUST00000227865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226973
Predicted Effect probably benign
Transcript: ENSMUST00000228311
Meta Mutation Damage Score 0.5324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Mutation of this gene result in homozygous lethality by E7.5 with various developmental defects observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 25,193,819 (GRCm39) C398S probably damaging Het
Adamts10 A G 17: 33,756,304 (GRCm39) K316E possibly damaging Het
Ap1m1 T C 8: 73,006,717 (GRCm39) F238L possibly damaging Het
Aph1a T A 3: 95,803,088 (GRCm39) D180E probably benign Het
Atp9b A G 18: 80,935,093 (GRCm39) F201L probably benign Het
Btbd9 A C 17: 30,704,561 (GRCm39) probably benign Het
C2cd5 T C 6: 142,975,910 (GRCm39) T768A probably benign Het
Casq1 C T 1: 172,037,965 (GRCm39) probably benign Het
Cimap2 C A 4: 106,467,612 (GRCm39) M341I probably benign Het
Cltc A T 11: 86,617,196 (GRCm39) M351K probably benign Het
Cnp A G 11: 100,469,877 (GRCm39) E271G possibly damaging Het
Col22a1 T C 15: 71,845,544 (GRCm39) D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 (GRCm39) S117P probably benign Het
Cyp2b13 T C 7: 25,761,072 (GRCm39) L43P probably damaging Het
Cyp3a16 A G 5: 145,373,267 (GRCm39) V500A probably benign Het
Dclk2 T C 3: 86,743,683 (GRCm39) D262G probably damaging Het
Dcun1d3 A C 7: 119,458,742 (GRCm39) Y98D probably damaging Het
Ddx39b A G 17: 35,472,464 (GRCm39) *429W probably null Het
Dennd5b T C 6: 148,908,335 (GRCm39) N986S probably damaging Het
Dipk1a T C 5: 108,057,982 (GRCm39) probably null Het
Dusp9 G A X: 72,684,378 (GRCm39) R182Q probably benign Het
Ecpas A T 4: 58,834,523 (GRCm39) I785N possibly damaging Het
Edil3 A G 13: 89,437,589 (GRCm39) K397E probably damaging Het
Ehd1 T C 19: 6,326,994 (GRCm39) probably benign Het
Fam13a A T 6: 58,964,152 (GRCm39) H93Q probably benign Het
Farp1 T C 14: 121,513,716 (GRCm39) I837T possibly damaging Het
Fbxl5 T A 5: 43,922,771 (GRCm39) I216F probably damaging Het
Gadl1 G A 9: 115,770,408 (GRCm39) E74K probably damaging Het
Hdac10 C T 15: 89,011,036 (GRCm39) probably benign Het
Heatr5b T C 17: 79,128,130 (GRCm39) S502G possibly damaging Het
Hr C A 14: 70,801,013 (GRCm39) A695E probably damaging Het
Ift80 A T 3: 68,825,870 (GRCm39) I490N possibly damaging Het
Ipo11 A G 13: 106,970,692 (GRCm39) probably benign Het
Iqch T G 9: 63,432,195 (GRCm39) Y400S probably damaging Het
Jag2 C T 12: 112,877,266 (GRCm39) D702N probably benign Het
Kiss1r T A 10: 79,757,624 (GRCm39) L326Q probably damaging Het
Lrrc42 A T 4: 107,104,746 (GRCm39) I73N probably damaging Het
Lrrc55 C T 2: 85,026,880 (GRCm39) G48D possibly damaging Het
Lrrk2 T C 15: 91,649,884 (GRCm39) S1674P probably damaging Het
Mctp2 A G 7: 71,739,942 (GRCm39) L816P probably damaging Het
Mipol1 A T 12: 57,352,918 (GRCm39) T86S probably benign Het
Mkrn3 C T 7: 62,069,452 (GRCm39) R113H probably damaging Het
Mmp1b A G 9: 7,370,849 (GRCm39) V302A probably benign Het
Msc A T 1: 14,826,053 (GRCm39) probably null Het
Msmo1 C A 8: 65,180,888 (GRCm39) V9L probably benign Het
Nbeal2 G A 9: 110,461,072 (GRCm39) R1630C probably damaging Het
Nlgn1 C T 3: 26,187,850 (GRCm39) V12I possibly damaging Het
Npas3 T C 12: 54,108,915 (GRCm39) probably null Het
Nr2e3 A G 9: 59,856,355 (GRCm39) probably benign Het
Oca2 C T 7: 55,978,560 (GRCm39) A576V probably benign Het
Or5b21 T A 19: 12,839,596 (GRCm39) C152* probably null Het
Or6d12 T C 6: 116,493,409 (GRCm39) Y224H probably damaging Het
Or6z7 T C 7: 6,484,045 (GRCm39) T37A probably benign Het
Parp6 A G 9: 59,548,383 (GRCm39) probably null Het
Pate13 T A 9: 35,820,287 (GRCm39) C4S probably damaging Het
Phlpp1 A T 1: 106,267,231 (GRCm39) M715L probably benign Het
Pi4k2a G A 19: 42,101,544 (GRCm39) probably null Het
Pik3ap1 A G 19: 41,316,348 (GRCm39) S305P probably damaging Het
Plcg2 G A 8: 118,231,054 (GRCm39) M45I probably benign Het
Ppm1m A T 9: 106,073,601 (GRCm39) L317H probably damaging Het
Ppp1r21 T G 17: 88,866,227 (GRCm39) M341R probably benign Het
Prdx3 A G 19: 60,853,674 (GRCm39) V217A possibly damaging Het
Ptk2b A G 14: 66,400,496 (GRCm39) V773A possibly damaging Het
Raly T C 2: 154,699,376 (GRCm39) V60A probably damaging Het
Reps1 A G 10: 17,990,148 (GRCm39) D420G probably damaging Het
Rev1 A T 1: 38,118,337 (GRCm39) probably benign Het
Rgs2 T G 1: 143,878,650 (GRCm39) probably benign Het
Rlf G T 4: 121,007,798 (GRCm39) T394K probably benign Het
Rptn A T 3: 93,304,792 (GRCm39) R708S possibly damaging Het
Sec23b T A 2: 144,414,494 (GRCm39) M402K probably benign Het
Skic2 A G 17: 35,068,922 (GRCm39) C26R probably damaging Het
Slx9 T C 10: 77,325,860 (GRCm39) M170V possibly damaging Het
Smpd4 A G 16: 17,459,992 (GRCm39) probably benign Het
Synj2 A G 17: 6,063,813 (GRCm39) E434G probably damaging Het
Tatdn2 T A 6: 113,684,326 (GRCm39) F64I probably benign Het
Tex21 A C 12: 76,263,860 (GRCm39) H177Q probably benign Het
Tln1 T A 4: 43,535,954 (GRCm39) Q2077L probably null Het
Tnrc6c T C 11: 117,611,797 (GRCm39) V145A probably benign Het
Ttn C T 2: 76,616,936 (GRCm39) probably benign Het
Uggt2 A G 14: 119,269,670 (GRCm39) F954S possibly damaging Het
Ugt2a1 A G 5: 87,634,083 (GRCm39) S175P probably damaging Het
Vcl A G 14: 21,035,820 (GRCm39) probably null Het
Vegfa A T 17: 46,336,176 (GRCm39) probably benign Het
Vmn2r68 G A 7: 84,882,769 (GRCm39) Q328* probably null Het
Vmn2r7 A G 3: 64,626,864 (GRCm39) Y142H probably benign Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Ybx3 G T 6: 131,347,290 (GRCm39) R282S probably damaging Het
Zfp566 T C 7: 29,777,194 (GRCm39) H329R probably damaging Het
Zfp786 T C 6: 47,797,868 (GRCm39) I357V probably benign Het
Zfr2 C A 10: 81,087,083 (GRCm39) probably null Het
Other mutations in Gnpnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02389:Gnpnat1 APN 14 45,618,388 (GRCm39) splice site probably null
R1987:Gnpnat1 UTSW 14 45,618,455 (GRCm39) missense probably damaging 1.00
R6103:Gnpnat1 UTSW 14 45,620,856 (GRCm39) missense probably damaging 1.00
R7395:Gnpnat1 UTSW 14 45,619,038 (GRCm39) missense probably benign 0.05
R7603:Gnpnat1 UTSW 14 45,622,074 (GRCm39) missense probably benign
R7852:Gnpnat1 UTSW 14 45,622,110 (GRCm39) missense probably damaging 1.00
R8092:Gnpnat1 UTSW 14 45,618,388 (GRCm39) splice site probably null
RF006:Gnpnat1 UTSW 14 45,620,900 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAGAACACTACTTGCCTAGC -3'
(R):5'- GCTTTAGCAGTACAGAGGGCAG -3'

Sequencing Primer
(F):5'- CACTACTTGCCTAGCATGTTAGAG -3'
(R):5'- CAGTACAGAGGGCAGGTTGAGC -3'
Posted On 2015-10-08