Incidental Mutation 'R4654:Synj2'
ID351580
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
MMRRC Submission 041914-MU
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6013538 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 434 (E434G)
Ref Sequence ENSEMBL: ENSMUSP00000060382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000115784] [ENSMUST00000115785] [ENSMUST00000115786] [ENSMUST00000115787] [ENSMUST00000115788] [ENSMUST00000115789] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000134767] [ENSMUST00000142409] [ENSMUST00000146009] [ENSMUST00000154114]
Predicted Effect probably damaging
Transcript: ENSMUST00000061091
AA Change: E434G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: E434G

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080283
AA Change: E519G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: E519G

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115784
SMART Domains Protein: ENSMUSP00000111450
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 3e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115785
AA Change: E203G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805
AA Change: E203G

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115786
AA Change: E279G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111452
Gene: ENSMUSG00000023805
AA Change: E279G

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.3e-29 PFAM
Blast:IPPc 239 268 1e-6 BLAST
IPPc 288 525 6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115787
SMART Domains Protein: ENSMUSP00000111453
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.7e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
low complexity region 977 994 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115789
SMART Domains Protein: ENSMUSP00000111455
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 187 2.3e-60 PFAM
Blast:IPPc 318 347 2e-6 BLAST
IPPc 367 709 3.72e-128 SMART
DUF1866 702 847 1.04e-73 SMART
low complexity region 850 864 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
low complexity region 1056 1073 N/A INTRINSIC
low complexity region 1102 1116 N/A INTRINSIC
low complexity region 1132 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115790
AA Change: E434G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: E434G

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115791
AA Change: E519G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: E519G

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130661
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably damaging
Transcript: ENSMUST00000142409
AA Change: E279G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120006
Gene: ENSMUSG00000023805
AA Change: E279G

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 2.5e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146009
AA Change: E519G

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122381
Gene: ENSMUSG00000023805
AA Change: E519G

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 3.6e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154114
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232567
Meta Mutation Damage Score 0.1223 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 splice site probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6029791 missense possibly damaging 0.68
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6016287 missense probably benign 0.33
R7799:Synj2 UTSW 17 6037823 missense probably benign 0.10
R7804:Synj2 UTSW 17 6019534 missense unknown
R7841:Synj2 UTSW 17 6044144 missense unknown
R8347:Synj2 UTSW 17 6009785 missense probably damaging 1.00
R8358:Synj2 UTSW 17 6023805 nonsense probably null
R8391:Synj2 UTSW 17 5941521 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGGTATGTGTCAGCCCTC -3'
(R):5'- TTACAAGGTGACACTCGCAG -3'

Sequencing Primer
(F):5'- TCTGTCATTCTCATATGGACCATG -3'
(R):5'- AGGTCGCCACCCTTACTGAC -3'
Posted On2015-10-08