Incidental Mutation 'R4640:Fam124b'
ID 351596
Institutional Source Beutler Lab
Gene Symbol Fam124b
Ensembl Gene ENSMUSG00000043230
Gene Name family with sequence similarity 124, member B
Synonyms
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4640 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 80198706-80218473 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80213526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 47 (R47C)
Ref Sequence ENSEMBL: ENSMUSP00000052208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058748]
AlphaFold Q8BLQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000058748
AA Change: R47C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052208
Gene: ENSMUSG00000043230
AA Change: R47C

DomainStartEndE-ValueType
Pfam:FAM124 10 244 1.2e-107 PFAM
low complexity region 288 297 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161427
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Fam124b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam124b APN 1 80213135 missense possibly damaging 0.95
IGL03384:Fam124b APN 1 80199956 missense probably benign
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R1403:Fam124b UTSW 1 80213339 missense possibly damaging 0.57
R1403:Fam124b UTSW 1 80213339 missense possibly damaging 0.57
R1514:Fam124b UTSW 1 80200431 missense possibly damaging 0.82
R1569:Fam124b UTSW 1 80213135 missense possibly damaging 0.95
R1983:Fam124b UTSW 1 80213647 missense probably benign 0.03
R3104:Fam124b UTSW 1 80213031 missense probably damaging 1.00
R5014:Fam124b UTSW 1 80200059 missense probably benign 0.00
R6180:Fam124b UTSW 1 80200185 missense possibly damaging 0.71
R7618:Fam124b UTSW 1 80213837 start gained probably benign
R7682:Fam124b UTSW 1 80213565 missense possibly damaging 0.87
R7720:Fam124b UTSW 1 80200257 missense probably damaging 1.00
R7812:Fam124b UTSW 1 80213634 missense probably damaging 1.00
R7877:Fam124b UTSW 1 80213336 missense probably damaging 1.00
R7898:Fam124b UTSW 1 80213795 start gained probably benign
R7989:Fam124b UTSW 1 80213594 missense probably damaging 1.00
R8851:Fam124b UTSW 1 80213165 missense probably damaging 1.00
R9022:Fam124b UTSW 1 80212988 missense probably damaging 1.00
R9292:Fam124b UTSW 1 80213504 missense probably benign 0.04
R9607:Fam124b UTSW 1 80213096 missense probably damaging 1.00
T0975:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0005:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0062:Fam124b UTSW 1 80212961 missense probably damaging 1.00
Z1176:Fam124b UTSW 1 80213403 missense possibly damaging 0.58
Z1177:Fam124b UTSW 1 80200088 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTGTGCAGACTGTAGAATTC -3'
(R):5'- TCGGGTGGCCTTCATCATAATC -3'

Sequencing Primer
(F):5'- CAGACTGTAGAATTCCTGATTGGCAG -3'
(R):5'- ATAATCTTCACATAGCCTGCCATGG -3'
Posted On 2015-10-08