Incidental Mutation 'R4640:Odf2l'
ID351599
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Nameouter dense fiber of sperm tails 2-like
Synonyms9630045K08Rik, 4733401D09Rik
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4640 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145118588-145153915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145128945 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 186 (R186H)
Ref Sequence ENSEMBL: ENSMUSP00000143513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192] [ENSMUST00000196552] [ENSMUST00000196857] [ENSMUST00000199124]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029920
AA Change: R143H

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: R143H

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098538
AA Change: R186H

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: R186H

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098539
AA Change: R186H

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: R186H

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106192
AA Change: R186H

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: R186H

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196552
Predicted Effect probably damaging
Transcript: ENSMUST00000196857
AA Change: R186H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143513
Gene: ENSMUSG00000028256
AA Change: R186H

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196898
Predicted Effect unknown
Transcript: ENSMUST00000198764
AA Change: R54H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199045
Predicted Effect probably benign
Transcript: ENSMUST00000199124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199307
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 145127873 missense possibly damaging 0.93
IGL00821:Odf2l APN 3 145150987 missense probably damaging 1.00
IGL01984:Odf2l APN 3 145139829 nonsense probably null
R0080:Odf2l UTSW 3 145124323 missense possibly damaging 0.63
R0133:Odf2l UTSW 3 145148541 missense probably damaging 0.96
R0436:Odf2l UTSW 3 145126116 missense possibly damaging 0.91
R1218:Odf2l UTSW 3 145148932 missense probably damaging 1.00
R1521:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R1677:Odf2l UTSW 3 145139782 critical splice acceptor site probably null
R1884:Odf2l UTSW 3 145151048 missense probably damaging 1.00
R2151:Odf2l UTSW 3 145149024 missense possibly damaging 0.86
R2910:Odf2l UTSW 3 145124323 missense probably benign 0.00
R2911:Odf2l UTSW 3 145124323 missense probably benign 0.00
R4552:Odf2l UTSW 3 145151083 missense probably benign 0.02
R4667:Odf2l UTSW 3 145128040 missense probably benign 0.04
R5472:Odf2l UTSW 3 145146866 missense probably benign 0.00
R5769:Odf2l UTSW 3 145135731 missense possibly damaging 0.91
R5877:Odf2l UTSW 3 145129010 unclassified probably null
R6026:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6351:Odf2l UTSW 3 145135718 missense probably benign 0.11
R6454:Odf2l UTSW 3 145153420 missense possibly damaging 0.93
R6462:Odf2l UTSW 3 145146911 missense probably damaging 1.00
R6888:Odf2l UTSW 3 145148618 critical splice donor site probably null
R7008:Odf2l UTSW 3 145132734 missense probably damaging 1.00
R7121:Odf2l UTSW 3 145139820 missense possibly damaging 0.93
R7151:Odf2l UTSW 3 145127066 missense probably benign 0.26
R7542:Odf2l UTSW 3 145153436 missense probably damaging 0.99
R7664:Odf2l UTSW 3 145148584 missense probably benign 0.41
R7811:Odf2l UTSW 3 145153387 missense probably benign 0.00
R7816:Odf2l UTSW 3 145151015 missense probably damaging 1.00
R7913:Odf2l UTSW 3 145153483 nonsense probably null
R7994:Odf2l UTSW 3 145153483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATGAGGCCACAGTATATGGAAAG -3'
(R):5'- TTCAGGCGAGACATCTCATGAC -3'

Sequencing Primer
(F):5'- CCACAGTATATGGAAAGGAATGTTC -3'
(R):5'- GTGTTTCCCACAGAAATGCC -3'
Posted On2015-10-08