Incidental Mutation 'R4640:Tcaf3'
ID 351604
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 041902-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R4640 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42564513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 883 (V883A)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: V883A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: V883A

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151898
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adgrl4 T C 3: 151,205,947 (GRCm39) probably benign Het
Ano4 C T 10: 88,790,559 (GRCm39) A847T probably damaging Het
Atp11a A G 8: 12,878,434 (GRCm39) probably benign Het
Cct4 T A 11: 22,952,297 (GRCm39) S463T probably benign Het
Cfap251 G T 5: 123,440,495 (GRCm39) V1094L probably benign Het
Cnmd T C 14: 79,894,093 (GRCm39) N98S probably damaging Het
Copz2 A T 11: 96,747,533 (GRCm39) Q172L possibly damaging Het
Ctdp1 C A 18: 80,494,369 (GRCm39) probably null Het
Cyfip1 C T 7: 55,563,199 (GRCm39) T865I possibly damaging Het
Cyp2c37 A T 19: 40,000,276 (GRCm39) D466V possibly damaging Het
Dytn A G 1: 63,682,507 (GRCm39) L380P possibly damaging Het
Fam124b G A 1: 80,191,243 (GRCm39) R47C probably damaging Het
Foxe3 G A 4: 114,782,972 (GRCm39) A80V probably damaging Het
Gm5884 A G 6: 128,622,734 (GRCm39) noncoding transcript Het
Kera A T 10: 97,448,749 (GRCm39) Y323F probably damaging Het
Lipf A T 19: 33,946,197 (GRCm39) Y205F probably damaging Het
Lipo2 T C 19: 33,698,237 (GRCm39) E380G probably benign Het
Mcm2 A T 6: 88,864,786 (GRCm39) H563Q possibly damaging Het
Mindy3 T C 2: 12,352,974 (GRCm39) E409G probably benign Het
Mns1 A G 9: 72,346,564 (GRCm39) K16E probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 (GRCm38) noncoding transcript Het
Nrxn1 A G 17: 90,868,196 (GRCm39) S1105P probably damaging Het
Odf2l G A 3: 144,834,706 (GRCm39) R186H probably damaging Het
Or13g1 T A 7: 85,956,274 (GRCm39) T16S probably benign Het
Or2d3c T C 7: 106,525,800 (GRCm39) I289V possibly damaging Het
Phxr2 T C 10: 98,961,931 (GRCm39) probably benign Het
Plcxd3 T C 15: 4,546,725 (GRCm39) F243S probably damaging Het
Ppp1r27 T C 11: 120,441,553 (GRCm39) N76D possibly damaging Het
Ptprz1 A G 6: 22,972,797 (GRCm39) T236A probably damaging Het
Pyroxd1 C G 6: 142,300,467 (GRCm39) S199* probably null Het
R3hdm1 T C 1: 128,102,975 (GRCm39) probably benign Het
Sall2 T A 14: 52,552,616 (GRCm39) Q193L probably damaging Het
Srpk1 T C 17: 28,827,698 (GRCm39) S39G probably benign Het
Tmem104 T A 11: 115,134,550 (GRCm39) V362E probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGGTCCCTAAAATTGAATCTTG -3'
(R):5'- TTCAGGAGTTGACTTGCAGG -3'

Sequencing Primer
(F):5'- AATCTTGAATCATTAGGGCTTTTCGG -3'
(R):5'- ACTTGCAGGTTGTATATGTCACTC -3'
Posted On 2015-10-08