Mutagenetix > Incidental Mutation

Incidental Mutation 'R4640:Tcaf3'

351604

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

041902-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R4640 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42587579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 883 (V883A)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023]

AlphaFold

Q6QR59

Predicted Effect

probably damaging
Transcript: ENSMUST00000069023
AA Change: V883A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: V883A

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151898

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

93% (39/42)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adgrl4	T	C	3: 151,500,310		probably benign	Het
Ano4	C	T	10: 88,954,697	A847T	probably damaging	Het
Atp11a	A	G	8: 12,828,434		probably benign	Het
Cct4	T	A	11: 23,002,297	S463T	probably benign	Het
Cnmd	T	C	14: 79,656,653	N98S	probably damaging	Het
Copz2	A	T	11: 96,856,707	Q172L	possibly damaging	Het
Ctdp1	C	A	18: 80,451,154		probably null	Het
Cyfip1	C	T	7: 55,913,451	T865I	possibly damaging	Het
Cyp2c37	A	T	19: 40,011,832	D466V	possibly damaging	Het
Dytn	A	G	1: 63,643,348	L380P	possibly damaging	Het
Fam124b	G	A	1: 80,213,526	R47C	probably damaging	Het
Foxe3	G	A	4: 114,925,775	A80V	probably damaging	Het
Gm5884	A	G	6: 128,645,771		noncoding transcript	Het
Kera	A	T	10: 97,612,887	Y323F	probably damaging	Het
Lipf	A	T	19: 33,968,797	Y205F	probably damaging	Het
Lipo2	T	C	19: 33,720,837	E380G	probably benign	Het
Mcm2	A	T	6: 88,887,804	H563Q	possibly damaging	Het
Mindy3	T	C	2: 12,348,163	E409G	probably benign	Het
Mns1	A	G	9: 72,439,282	K16E	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nlrp4g	T	C	9: 124,349,153		noncoding transcript	Het
Nrxn1	A	G	17: 90,560,768	S1105P	probably damaging	Het
Odf2l	G	A	3: 145,128,945	R186H	probably damaging	Het
Olfr309	T	A	7: 86,307,066	T16S	probably benign	Het
Olfr709-ps1	T	C	7: 106,926,593	I289V	possibly damaging	Het
Phxr2	T	C	10: 99,126,069		probably benign	Het
Plcxd3	T	C	15: 4,517,243	F243S	probably damaging	Het
Ppp1r27	T	C	11: 120,550,727	N76D	possibly damaging	Het
Ptprz1	A	G	6: 22,972,798	T236A	probably damaging	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
R3hdm1	T	C	1: 128,175,238		probably benign	Het
Sall2	T	A	14: 52,315,159	Q193L	probably damaging	Het
Srpk1	T	C	17: 28,608,724	S39G	probably benign	Het
Tmem104	T	A	11: 115,243,724	V362E	probably damaging	Het
Wdr66	G	T	5: 123,302,432	V1094L	probably benign	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGGTCCCTAAAATTGAATCTTG -3'
(R):5'- TTCAGGAGTTGACTTGCAGG -3'

Sequencing Primer
(F):5'- AATCTTGAATCATTAGGGCTTTTCGG -3'
(R):5'- ACTTGCAGGTTGTATATGTCACTC -3'

Posted On

2015-10-08