Incidental Mutation 'R4640:Mns1'
ID351612
Institutional Source Beutler Lab
Gene Symbol Mns1
Ensembl Gene ENSMUSG00000032221
Gene Namemeiosis-specific nuclear structural protein 1
Synonyms
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4640 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72438011-72462025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72439282 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 16 (K16E)
Ref Sequence ENSEMBL: ENSMUSP00000139105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034746] [ENSMUST00000183809] [ENSMUST00000184604]
Predicted Effect probably benign
Transcript: ENSMUST00000034746
AA Change: K16E

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034746
Gene: ENSMUSG00000032221
AA Change: K16E

DomainStartEndE-ValueType
Pfam:TPH 117 462 3.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183809
AA Change: K16E

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139105
Gene: ENSMUSG00000032221
AA Change: K16E

DomainStartEndE-ValueType
Pfam:Trichoplein 116 219 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184604
AA Change: K16E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139232
Gene: ENSMUSG00000032221
AA Change: K16E

DomainStartEndE-ValueType
Pfam:Trichoplein 116 158 8e-12 PFAM
Pfam:Trichoplein 150 206 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194708
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, male infertility, sperm flagellum abnormalities, immotile sperm, randomized left-right patterning, hydroencephaly, and motile cilia abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Mns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Mns1 APN 9 72456913 unclassified probably benign
R0390:Mns1 UTSW 9 72452804 missense probably damaging 1.00
R0512:Mns1 UTSW 9 72449471 missense possibly damaging 0.87
R1803:Mns1 UTSW 9 72452734 missense probably damaging 1.00
R1988:Mns1 UTSW 9 72448759 unclassified probably null
R3821:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R3822:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R6051:Mns1 UTSW 9 72449453 missense probably damaging 1.00
R6696:Mns1 UTSW 9 72452762 missense probably damaging 1.00
R6835:Mns1 UTSW 9 72452744 missense probably damaging 1.00
R7257:Mns1 UTSW 9 72452815 missense probably damaging 1.00
R7340:Mns1 UTSW 9 72448743 missense probably damaging 1.00
R7903:Mns1 UTSW 9 72452811 missense probably benign 0.04
R7986:Mns1 UTSW 9 72452811 missense probably benign 0.04
R8068:Mns1 UTSW 9 72448527 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAATCAGTACGCCGTTAAGTTTAC -3'
(R):5'- GATGGCTTCTTCCATGTCGAG -3'

Sequencing Primer
(F):5'- CAGTACGCCGTTAAGTTTACATTATC -3'
(R):5'- TCCATGTCGAGCTCAAACTG -3'
Posted On2015-10-08