Incidental Mutation 'R4640:Ano4'
ID351614
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission 041902-MU
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4640 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88954697 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 847 (A847T)
Ref Sequence ENSEMBL: ENSMUSP00000138325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect probably damaging
Transcript: ENSMUST00000182341
AA Change: A882T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: A882T

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect probably damaging
Transcript: ENSMUST00000182613
AA Change: A847T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: A847T

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182790
AA Change: A847T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: A847T

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Meta Mutation Damage Score 0.3649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAGTGAGGCTACATTATATGGCC -3'
(R):5'- GCTGGACAAAGTGACAGATGTCTAG -3'

Sequencing Primer
(F):5'- GCCATGGTGCTTTAGAAAGTCCATC -3'
(R):5'- TAGATATCGAGACTACCGGG -3'
Posted On2015-10-08