Incidental Mutation 'R4640:Cyp2c37'
ID351630
Institutional Source Beutler Lab
Gene Symbol Cyp2c37
Ensembl Gene ENSMUSG00000042248
Gene Namecytochrome P450, family 2. subfamily c, polypeptide 37
Synonyms
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4640 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39992424-40012243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40011832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 466 (D466V)
Ref Sequence ENSEMBL: ENSMUSP00000045362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049178
AA Change: D466V

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045362
Gene: ENSMUSG00000042248
AA Change: D466V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 5e-160 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Kera A T 10: 97,612,887 Y323F probably damaging Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Cyp2c37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cyp2c37 APN 19 40001997 missense probably benign 0.00
IGL01307:Cyp2c37 APN 19 39992579 missense probably benign 0.00
IGL01959:Cyp2c37 APN 19 39995833 nonsense probably null
IGL02580:Cyp2c37 APN 19 39994498 missense probably damaging 1.00
IGL02611:Cyp2c37 APN 19 39993865 missense probably benign 0.00
R0124:Cyp2c37 UTSW 19 39994102 missense probably damaging 1.00
R0391:Cyp2c37 UTSW 19 39994506 missense probably damaging 1.00
R0420:Cyp2c37 UTSW 19 39995794 missense probably benign 0.00
R0782:Cyp2c37 UTSW 19 39993825 missense probably benign 0.00
R1413:Cyp2c37 UTSW 19 39994098 missense probably benign 0.21
R1637:Cyp2c37 UTSW 19 40001982 nonsense probably null
R1688:Cyp2c37 UTSW 19 39994443 splice site probably null
R2258:Cyp2c37 UTSW 19 39995859 missense possibly damaging 0.49
R4353:Cyp2c37 UTSW 19 40000545 missense possibly damaging 0.66
R4965:Cyp2c37 UTSW 19 40011762 missense possibly damaging 0.79
R5053:Cyp2c37 UTSW 19 40001887 missense probably benign 0.00
R5645:Cyp2c37 UTSW 19 39994152 missense probably benign 0.04
R5847:Cyp2c37 UTSW 19 40011732 missense probably damaging 0.98
R6487:Cyp2c37 UTSW 19 39994581 missense probably benign
R6631:Cyp2c37 UTSW 19 40009843 missense probably damaging 1.00
R7062:Cyp2c37 UTSW 19 39995546 intron probably null
Predicted Primers PCR Primer
(F):5'- AGCCATTCGTCCATCTAACC -3'
(R):5'- ACTGGATAAAAGTCAGTGTTTCCAG -3'

Sequencing Primer
(F):5'- ATTCGTCCATCTAACCATACATCG -3'
(R):5'- ATAAAAGTCAGTGTTTCCAGTGTGG -3'
Posted On2015-10-08