Incidental Mutation 'R4641:Ift122'
ID 351639
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4641 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 115888765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 339 (K339*)
Ref Sequence ENSEMBL: ENSMUSP00000108547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably null
Transcript: ENSMUST00000038234
AA Change: K339*
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: K339*

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112923
AA Change: K398*
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: K398*

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112925
AA Change: K339*
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: K339*

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138113
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152092
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAGTTGTTAGCAGACTGAC -3'
(R):5'- TTCTTTCCCTGAGGTAGAGCC -3'

Sequencing Primer
(F):5'- AGCAGTGCTCTTGAACACTG -3'
(R):5'- TGAGGTAGAGCCCTGCC -3'
Posted On 2015-10-08