Incidental Mutation 'R4641:Rnf123'
ID351645
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Namering finger protein 123
SynonymsKPC1
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4641 (G1)
Quality Score222
Status Not validated
Chromosome9
Chromosomal Location108051534-108083346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108058587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 920 (D920G)
Ref Sequence ENSEMBL: ENSMUSP00000125495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000085060] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: D926G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: D926G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085060
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect unknown
Transcript: ENSMUST00000159306
AA Change: D51G
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528
AA Change: D51G

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: D920G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: D920G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: D920G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: D920G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162123
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: D926G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: D926G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162753
AA Change: T60A
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: D920G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: D920G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 unclassified probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 intron probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTGCCAAAAGGTTCCTC -3'
(R):5'- GCACTGGTGAGATGTCTTCC -3'

Sequencing Primer
(F):5'- GTTCCTCACCATGGCGATG -3'
(R):5'- AGATGTCTTCCAGGGGGC -3'
Posted On2015-10-08