Incidental Mutation 'R4641:P2rx5'
ID351653
Institutional Source Beutler Lab
Gene Symbol P2rx5
Ensembl Gene ENSMUSG00000005950
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 5
SynonymsP2X5
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4641 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73160421-73172685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73167564 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 275 (H275L)
Ref Sequence ENSEMBL: ENSMUSP00000006104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006104] [ENSMUST00000135202] [ENSMUST00000136894]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006104
AA Change: H275L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006104
Gene: ENSMUSG00000005950
AA Change: H275L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 382 2.1e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135202
AA Change: H251L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118448
Gene: ENSMUSG00000005950
AA Change: H251L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 307 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136894
AA Change: H275L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121834
Gene: ENSMUSG00000005950
AA Change: H275L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 331 2.9e-144 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit decreased peripheral blood CD8+ lymphocytes and elevated NK cells. Impaired learning/memory during trace aversive conditioning and increased exploratory behavior during open field testing is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in P2rx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:P2rx5 APN 11 73167492 critical splice acceptor site probably null
IGL01860:P2rx5 APN 11 73165559 missense probably damaging 0.98
IGL02019:P2rx5 APN 11 73167977 splice site probably benign
IGL03079:P2rx5 APN 11 73164888 missense possibly damaging 0.92
IGL03088:P2rx5 APN 11 73165620 splice site probably benign
R0014:P2rx5 UTSW 11 73167062 splice site probably benign
R0845:P2rx5 UTSW 11 73165574 missense probably damaging 1.00
R1384:P2rx5 UTSW 11 73167890 missense probably damaging 1.00
R3415:P2rx5 UTSW 11 73160660 missense possibly damaging 0.94
R4155:P2rx5 UTSW 11 73171829 missense probably damaging 0.96
R4750:P2rx5 UTSW 11 73164877 missense probably damaging 1.00
R4854:P2rx5 UTSW 11 73171779 missense probably benign 0.23
R5186:P2rx5 UTSW 11 73171790 missense possibly damaging 0.68
R7003:P2rx5 UTSW 11 73167974 critical splice donor site probably null
R7141:P2rx5 UTSW 11 73160648 missense probably damaging 1.00
R7312:P2rx5 UTSW 11 73164866 missense probably damaging 1.00
X0004:P2rx5 UTSW 11 73166989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAAAGTGTGGTCCTGCC -3'
(R):5'- ACCTGCTCACTGAGGCAAATAC -3'

Sequencing Primer
(F):5'- CAGACCTCTGGCTGACTCGTG -3'
(R):5'- GGCAAATACAAAGTCTGGGCTTTCC -3'
Posted On2015-10-08