Incidental Mutation 'R4641:Spata31d1c'
ID351657
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4641 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65035048 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 135 (Q135K)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably benign
Transcript: ENSMUST00000099427
AA Change: Q135K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: Q135K

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8513:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
R8917:Spata31d1c UTSW 13 65035615 missense probably benign 0.02
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CAGGCAGGCCCTTTTCAATTC -3'
(R):5'- TAGTAGAGAGCCACCCAGTG -3'

Sequencing Primer
(F):5'- GCAGGCCCTTTTCAATTCTGGTC -3'
(R):5'- GAAAGTGTGTCTTCTAGGTACTCAC -3'
Posted On2015-10-08