Incidental Mutation 'R4641:Letmd1'
ID 351661
Institutional Source Beutler Lab
Gene Symbol Letmd1
Ensembl Gene ENSMUSG00000037353
Gene Name LETM1 domain containing 1
Synonyms HCCR1, 1110019O13Rik, HCCR-2
MMRRC Submission 041903-MU
Accession Numbers

Ncbi RefSeq: NM_134093.2; MGI:1915864

Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R4641 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 100469023-100479164 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100477827 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 198 (Y198C)
Ref Sequence ENSEMBL: ENSMUSP00000155807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037001] [ENSMUST00000061457] [ENSMUST00000229012] [ENSMUST00000229648] [ENSMUST00000230294]
AlphaFold Q924L1
Predicted Effect probably damaging
Transcript: ENSMUST00000037001
AA Change: Y355C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037546
Gene: ENSMUSG00000037353
AA Change: Y355C

DomainStartEndE-ValueType
Pfam:LETM1 78 346 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061457
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229596
Predicted Effect probably damaging
Transcript: ENSMUST00000229648
AA Change: Y266C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230294
AA Change: Y198C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231001
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial outer membrane protein. It has a potential role in tumorigenesis, which may result from negative regulation of the p53 tumor suppressor gene. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Letmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Letmd1 APN 15 100471759 missense probably damaging 1.00
IGL02210:Letmd1 APN 15 100469247 critical splice donor site probably null
IGL02486:Letmd1 APN 15 100475111 missense probably damaging 1.00
IGL02606:Letmd1 APN 15 100475091 missense probably damaging 1.00
IGL03218:Letmd1 APN 15 100469828 missense probably damaging 1.00
lass UTSW 15 100472542 splice site probably null
P0031:Letmd1 UTSW 15 100472609 missense probably damaging 1.00
PIT4515001:Letmd1 UTSW 15 100476802 missense probably damaging 1.00
R0737:Letmd1 UTSW 15 100469821 missense probably damaging 1.00
R1466:Letmd1 UTSW 15 100472542 splice site probably null
R1466:Letmd1 UTSW 15 100472542 splice site probably null
R1584:Letmd1 UTSW 15 100472542 splice site probably null
R4457:Letmd1 UTSW 15 100475130 missense possibly damaging 0.54
R4724:Letmd1 UTSW 15 100469738 missense probably damaging 1.00
R5463:Letmd1 UTSW 15 100469128 missense probably damaging 1.00
R7407:Letmd1 UTSW 15 100469238 missense probably benign 0.08
R8852:Letmd1 UTSW 15 100475366 missense probably benign 0.01
Y5407:Letmd1 UTSW 15 100475409 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACACAAGCATGCTTTCAGGG -3'
(R):5'- GTTAGGCTCAAGCTGTGAAGG -3'

Sequencing Primer
(F):5'- CAAGCATGCTTTCAGGGTCTGG -3'
(R):5'- CTGTGAAGGAATGTCTATAGCTCCC -3'
Posted On 2015-10-08