Incidental Mutation 'R4641:Mdc1'
ID351664
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4641 (G1)
Quality Score221
Status Not validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 35857469 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1656 (R1656G)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000082337] [ENSMUST00000174873]
Predicted Effect probably benign
Transcript: ENSMUST00000074259
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: R1656G

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: R1656G

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect probably benign
Transcript: ENSMUST00000172931
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174873
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGAGAATATTCCTCAGTCAGG -3'
(R):5'- ACTGTTCGATGGTCTGAGAAGG -3'

Sequencing Primer
(F):5'- CCTAGCATATACAGAACTGGGCTTG -3'
(R):5'- CTGTTCGATGGTCTGAGAAGGTAAAG -3'
Posted On2015-10-08