Incidental Mutation 'R4641:Stard8'
ID351666
Institutional Source Beutler Lab
Gene Symbol Stard8
Ensembl Gene ENSMUSG00000031216
Gene NameSTART domain containing 8
Synonyms
MMRRC Submission 041903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4641 (G1)
Quality Score101
Status Not validated
ChromosomeX
Chromosomal Location99003248-99074728 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 99066508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036606] [ENSMUST00000149999]
Predicted Effect probably benign
Transcript: ENSMUST00000036606
SMART Domains Protein: ENSMUSP00000044491
Gene: ENSMUSG00000031216

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
coiled coil region 334 372 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
low complexity region 457 464 N/A INTRINSIC
RhoGAP 579 770 1.97e-56 SMART
START 814 1016 2.13e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145820
Predicted Effect probably benign
Transcript: ENSMUST00000149999
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,806,882 D68G probably damaging Het
Abca7 G A 10: 80,005,781 probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
Dsg3 T A 18: 20,520,558 F54I probably benign Het
Ehbp1 G A 11: 22,095,892 S619L probably benign Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fbxw14 A G 9: 109,278,682 probably null Het
Fhod1 C T 8: 105,329,592 R1163H probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm2016 A G 12: 87,876,676 Y31C probably damaging Het
Gm2046 A G 12: 87,980,082 D98G probably benign Het
Gm4846 G A 1: 166,483,893 P466S probably damaging Het
Ift122 A T 6: 115,888,765 K339* probably null Het
Il6st T C 13: 112,488,530 S227P probably damaging Het
Letmd1 A G 15: 100,477,827 Y198C probably damaging Het
Map3k4 A T 17: 12,264,045 L595Q probably damaging Het
Mdc1 C G 17: 35,857,469 R1656G probably benign Het
Megf11 C T 9: 64,690,125 S662L possibly damaging Het
Mrps25 T C 6: 92,183,900 E25G probably benign Het
Myh2 G T 11: 67,194,694 G1815C probably damaging Het
Myo15 A G 11: 60,503,041 D2353G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
P2rx5 A T 11: 73,167,564 H275L possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rnf123 T C 9: 108,058,587 D920G probably damaging Het
Slc44a2 A G 9: 21,346,882 Y474C probably damaging Het
Slc9a4 T A 1: 40,607,125 F439I probably damaging Het
Snap91 A G 9: 86,879,475 V26A probably damaging Het
Spata31d1c C A 13: 65,035,048 Q135K probably benign Het
Tlk2 T C 11: 105,275,983 I669T probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Ttn T A 2: 76,786,811 Y16403F probably damaging Het
Ttyh2 G T 11: 114,701,783 W213L probably damaging Het
Ugt2a2 A T 5: 87,462,896 D360E probably damaging Het
Vwa5b2 A T 16: 20,604,643 H1102L probably damaging Het
Zbtb41 A T 1: 139,442,819 T665S probably damaging Het
Zfp292 T C 4: 34,807,828 I1739V probably damaging Het
Other mutations in Stard8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Stard8 APN X 99069335 missense probably damaging 1.00
IGL01063:Stard8 APN X 99073088 missense probably damaging 1.00
FR4304:Stard8 UTSW X 99066505 unclassified probably benign
FR4976:Stard8 UTSW X 99066513 unclassified probably benign
FR4976:Stard8 UTSW X 99066525 unclassified probably benign
R4198:Stard8 UTSW X 99066508 unclassified probably benign
R8246:Stard8 UTSW X 99065964 missense probably benign
R8247:Stard8 UTSW X 99065964 missense probably benign
RF002:Stard8 UTSW X 99066515 nonsense probably null
RF010:Stard8 UTSW X 99066517 unclassified probably benign
RF043:Stard8 UTSW X 99066520 unclassified probably benign
RF043:Stard8 UTSW X 99066527 unclassified probably benign
RF051:Stard8 UTSW X 99066524 unclassified probably benign
RF055:Stard8 UTSW X 99066520 unclassified probably benign
RF063:Stard8 UTSW X 99066524 nonsense probably null
RF064:Stard8 UTSW X 99066527 nonsense probably null
X0004:Stard8 UTSW X 99066683 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGTACCCAGCTGAGCCTATAC -3'
(R):5'- GCAGTCGAGTTAGCTTCTTGC -3'

Sequencing Primer
(F):5'- CCTATACAGGCTGAAGCTGAGGC -3'
(R):5'- AGCCTGTACCAATGGTTCGAC -3'
Posted On2015-10-08