Incidental Mutation 'R4642:Cpxm2'
ID351683
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Namecarboxypeptidase X 2 (M14 family)
Synonyms4632435C11Rik
MMRRC Submission 041904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4642 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132032687-132154739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132070881 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 313 (R313H)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000033149
AA Change: R313H

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: R313H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127039
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 T C 8: 79,689,353 T387A probably damaging Het
Acaca A T 11: 84,280,461 T3S probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Cacna1g A G 11: 94,418,094 I1631T probably damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Ccbe1 A T 18: 66,291,583 probably benign Het
Ccdc184 T G 15: 98,168,656 V114G probably benign Het
Crebrf G T 17: 26,743,061 E377D probably benign Het
Dcstamp T C 15: 39,754,722 F176L probably benign Het
Dnah2 T C 11: 69,496,559 D947G probably benign Het
Erbb4 A G 1: 68,250,632 I750T probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm16391 T G 17: 76,284,831 noncoding transcript Het
Gm973 A T 1: 59,558,114 E434D probably damaging Het
Hdac7 T C 15: 97,806,516 E491G probably damaging Het
Hyal5 A G 6: 24,876,622 N165D probably benign Het
Ly86 A T 13: 37,376,901 R79S possibly damaging Het
Mapk7 A G 11: 61,490,901 I13T probably damaging Het
Medag T A 5: 149,411,979 M1K probably null Het
Myh9 T C 15: 77,761,951 D1944G probably benign Het
Nadk2 T C 15: 9,092,721 W206R possibly damaging Het
Olfr830 T A 9: 18,876,167 M280K probably damaging Het
Pcdhb11 T A 18: 37,421,968 F117Y probably benign Het
Pdzd8 C T 19: 59,305,230 E396K probably damaging Het
Piezo1 T A 8: 122,495,454 Y541F probably damaging Het
Polr3h T C 15: 81,922,466 I51V probably benign Het
Prune2 T C 19: 17,020,655 probably null Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rars2 T G 4: 34,656,229 V461G probably damaging Het
Rasgrp3 T C 17: 75,498,448 C145R possibly damaging Het
Ryr1 T C 7: 29,086,038 T1743A possibly damaging Het
Sac3d1 G A 19: 6,116,404 A325V possibly damaging Het
Shank1 A T 7: 44,313,141 D93V unknown Het
Smg1 T C 7: 118,154,264 probably benign Het
Tbl1xr1 A T 3: 22,188,420 N38I probably damaging Het
Ufc1 A G 1: 171,289,894 I82T probably benign Het
Uggt2 A T 14: 119,034,935 M434K probably benign Het
Unc80 G A 1: 66,671,714 probably null Het
Zan T A 5: 137,464,188 T910S unknown Het
Zfp64 A G 2: 168,934,931 C256R probably benign Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 132128350 critical splice donor site probably null
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 132154306 missense probably benign
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6468:Cpxm2 UTSW 7 132070860 missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
R7938:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7950:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
RF014:Cpxm2 UTSW 7 132070863 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGGACTAAAGACTTCAATGCC -3'
(R):5'- CATGCTTCCTGGTGACTTGG -3'

Sequencing Primer
(F):5'- TCAGCCATTTCCTAGCAGAG -3'
(R):5'- GGTGACTTGGCTCCCTTGC -3'
Posted On2015-10-08