Incidental Mutation 'R4642:Gas2l3'
ID351687
Institutional Source Beutler Lab
Gene Symbol Gas2l3
Ensembl Gene ENSMUSG00000074802
Gene Namegrowth arrest-specific 2 like 3
Synonyms8430435B07Rik, LOC237436
MMRRC Submission 041904-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4642 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location89408823-89443967 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) CACTCGTCATACT to CACT at 89430958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099374] [ENSMUST00000105298] [ENSMUST00000218764] [ENSMUST00000219351] [ENSMUST00000220071] [ENSMUST00000220128] [ENSMUST00000220234]
Predicted Effect probably benign
Transcript: ENSMUST00000099374
SMART Domains Protein: ENSMUSP00000096973
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 215 284 1.8e-29 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105298
SMART Domains Protein: ENSMUSP00000100935
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 213 286 1.5e-31 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219073
Predicted Effect probably benign
Transcript: ENSMUST00000219351
Predicted Effect probably benign
Transcript: ENSMUST00000220071
Predicted Effect probably benign
Transcript: ENSMUST00000220128
Predicted Effect probably benign
Transcript: ENSMUST00000220234
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial postnatal lethality with none surviving past 4 months, dilated cardiomyopathy, cardiac interstitial fibrosis, and premature binucleation of cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 T C 8: 79,689,353 T387A probably damaging Het
Acaca A T 11: 84,280,461 T3S probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Cacna1g A G 11: 94,418,094 I1631T probably damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Ccbe1 A T 18: 66,291,583 probably benign Het
Ccdc184 T G 15: 98,168,656 V114G probably benign Het
Cpxm2 C T 7: 132,070,881 R313H probably benign Het
Crebrf G T 17: 26,743,061 E377D probably benign Het
Dcstamp T C 15: 39,754,722 F176L probably benign Het
Dnah2 T C 11: 69,496,559 D947G probably benign Het
Erbb4 A G 1: 68,250,632 I750T probably damaging Het
Gm16391 T G 17: 76,284,831 noncoding transcript Het
Gm973 A T 1: 59,558,114 E434D probably damaging Het
Hdac7 T C 15: 97,806,516 E491G probably damaging Het
Hyal5 A G 6: 24,876,622 N165D probably benign Het
Ly86 A T 13: 37,376,901 R79S possibly damaging Het
Mapk7 A G 11: 61,490,901 I13T probably damaging Het
Medag T A 5: 149,411,979 M1K probably null Het
Myh9 T C 15: 77,761,951 D1944G probably benign Het
Nadk2 T C 15: 9,092,721 W206R possibly damaging Het
Olfr830 T A 9: 18,876,167 M280K probably damaging Het
Pcdhb11 T A 18: 37,421,968 F117Y probably benign Het
Pdzd8 C T 19: 59,305,230 E396K probably damaging Het
Piezo1 T A 8: 122,495,454 Y541F probably damaging Het
Polr3h T C 15: 81,922,466 I51V probably benign Het
Prune2 T C 19: 17,020,655 probably null Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rars2 T G 4: 34,656,229 V461G probably damaging Het
Rasgrp3 T C 17: 75,498,448 C145R possibly damaging Het
Ryr1 T C 7: 29,086,038 T1743A possibly damaging Het
Sac3d1 G A 19: 6,116,404 A325V possibly damaging Het
Shank1 A T 7: 44,313,141 D93V unknown Het
Smg1 T C 7: 118,154,264 probably benign Het
Tbl1xr1 A T 3: 22,188,420 N38I probably damaging Het
Ufc1 A G 1: 171,289,894 I82T probably benign Het
Uggt2 A T 14: 119,034,935 M434K probably benign Het
Unc80 G A 1: 66,671,714 probably null Het
Zan T A 5: 137,464,188 T910S unknown Het
Zfp64 A G 2: 168,934,931 C256R probably benign Het
Other mutations in Gas2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gas2l3 APN 10 89413627 missense probably benign 0.00
IGL01148:Gas2l3 APN 10 89413504 missense probably benign 0.25
R0472:Gas2l3 UTSW 10 89426477 missense probably damaging 1.00
R0578:Gas2l3 UTSW 10 89417075 missense probably damaging 1.00
R0720:Gas2l3 UTSW 10 89413943 missense probably benign 0.00
R1386:Gas2l3 UTSW 10 89414353 missense possibly damaging 0.77
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1530:Gas2l3 UTSW 10 89433769 missense probably benign 0.02
R1733:Gas2l3 UTSW 10 89414265 missense probably damaging 1.00
R1772:Gas2l3 UTSW 10 89417014 unclassified probably benign
R1840:Gas2l3 UTSW 10 89422251 missense possibly damaging 0.79
R2168:Gas2l3 UTSW 10 89414098 missense probably benign 0.01
R3082:Gas2l3 UTSW 10 89430958 small deletion probably benign
R3083:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4639:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4641:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4643:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4644:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4645:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4809:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4810:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4820:Gas2l3 UTSW 10 89417045 missense probably damaging 1.00
R4852:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4853:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4855:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4865:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4900:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4906:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4926:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4946:Gas2l3 UTSW 10 89413772 missense probably benign
R5072:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5073:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5074:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5137:Gas2l3 UTSW 10 89413975 missense probably damaging 1.00
R5579:Gas2l3 UTSW 10 89414066 missense probably benign
R5919:Gas2l3 UTSW 10 89417055 missense probably damaging 1.00
R6573:Gas2l3 UTSW 10 89422210 splice site probably null
R6763:Gas2l3 UTSW 10 89413369 missense probably benign 0.00
R6961:Gas2l3 UTSW 10 89413291 missense probably benign 0.00
R7491:Gas2l3 UTSW 10 89413901 missense probably benign 0.02
R7707:Gas2l3 UTSW 10 89414358 missense probably damaging 1.00
R7806:Gas2l3 UTSW 10 89413370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTGACTCTGACATTCACTG -3'
(R):5'- GACATCAACCACTGTATTCAATGC -3'

Sequencing Primer
(F):5'- ACTGAGTATCCCTGGCATCTGG -3'
(R):5'- ACAATTTTGCTTATTCTGGATGGTC -3'
Posted On2015-10-08