Incidental Mutation 'R4642:Dcstamp'
ID351694
Institutional Source Beutler Lab
Gene Symbol Dcstamp
Ensembl Gene ENSMUSG00000022303
Gene Namedendrocyte expressed seven transmembrane protein
SynonymsTm7sf4, 4833414I07Rik, DC-STAMP
MMRRC Submission 041904-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R4642 (G1)
Quality Score147
Status Validated
Chromosome15
Chromosomal Location39745930-39760938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39754722 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 176 (F176L)
Ref Sequence ENSEMBL: ENSMUSP00000153957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022913] [ENSMUST00000227368] [ENSMUST00000227792] [ENSMUST00000228556] [ENSMUST00000228701]
Predicted Effect probably benign
Transcript: ENSMUST00000022913
AA Change: F176L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000022913
Gene: ENSMUSG00000022303
AA Change: F176L

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 58 75 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:DC_STAMP 242 421 1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227368
AA Change: F176L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000227792
AA Change: F176L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228556
AA Change: F176L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000228701
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Targeted disruption of this gene causes complete loss of osteoclast and macrophage cell fusion and leads to reduced bone-resorbing activity and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 T C 8: 79,689,353 T387A probably damaging Het
Acaca A T 11: 84,280,461 T3S probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Cacna1g A G 11: 94,418,094 I1631T probably damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Ccbe1 A T 18: 66,291,583 probably benign Het
Ccdc184 T G 15: 98,168,656 V114G probably benign Het
Cpxm2 C T 7: 132,070,881 R313H probably benign Het
Crebrf G T 17: 26,743,061 E377D probably benign Het
Dnah2 T C 11: 69,496,559 D947G probably benign Het
Erbb4 A G 1: 68,250,632 I750T probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm16391 T G 17: 76,284,831 noncoding transcript Het
Gm973 A T 1: 59,558,114 E434D probably damaging Het
Hdac7 T C 15: 97,806,516 E491G probably damaging Het
Hyal5 A G 6: 24,876,622 N165D probably benign Het
Ly86 A T 13: 37,376,901 R79S possibly damaging Het
Mapk7 A G 11: 61,490,901 I13T probably damaging Het
Medag T A 5: 149,411,979 M1K probably null Het
Myh9 T C 15: 77,761,951 D1944G probably benign Het
Nadk2 T C 15: 9,092,721 W206R possibly damaging Het
Olfr830 T A 9: 18,876,167 M280K probably damaging Het
Pcdhb11 T A 18: 37,421,968 F117Y probably benign Het
Pdzd8 C T 19: 59,305,230 E396K probably damaging Het
Piezo1 T A 8: 122,495,454 Y541F probably damaging Het
Polr3h T C 15: 81,922,466 I51V probably benign Het
Prune2 T C 19: 17,020,655 probably null Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rars2 T G 4: 34,656,229 V461G probably damaging Het
Rasgrp3 T C 17: 75,498,448 C145R possibly damaging Het
Ryr1 T C 7: 29,086,038 T1743A possibly damaging Het
Sac3d1 G A 19: 6,116,404 A325V possibly damaging Het
Shank1 A T 7: 44,313,141 D93V unknown Het
Smg1 T C 7: 118,154,264 probably benign Het
Tbl1xr1 A T 3: 22,188,420 N38I probably damaging Het
Ufc1 A G 1: 171,289,894 I82T probably benign Het
Uggt2 A T 14: 119,034,935 M434K probably benign Het
Unc80 G A 1: 66,671,714 probably null Het
Zan T A 5: 137,464,188 T910S unknown Het
Zfp64 A G 2: 168,934,931 C256R probably benign Het
Other mutations in Dcstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Dcstamp APN 15 39754416 missense probably benign 0.05
IGL01963:Dcstamp APN 15 39760359 missense possibly damaging 0.82
IGL02132:Dcstamp APN 15 39754532 missense probably damaging 0.97
IGL02139:Dcstamp APN 15 39754458 missense probably damaging 1.00
IGL02607:Dcstamp APN 15 39754584 missense possibly damaging 0.94
IGL03003:Dcstamp APN 15 39754510 missense possibly damaging 0.64
IGL03061:Dcstamp APN 15 39760397 missense possibly damaging 0.81
IGL03191:Dcstamp APN 15 39754224 missense probably benign 0.00
R1144:Dcstamp UTSW 15 39760368 missense possibly damaging 0.94
R1186:Dcstamp UTSW 15 39754629 unclassified probably null
R1663:Dcstamp UTSW 15 39754944 nonsense probably null
R2117:Dcstamp UTSW 15 39755175 nonsense probably null
R2202:Dcstamp UTSW 15 39754312 missense probably damaging 0.99
R4484:Dcstamp UTSW 15 39754224 missense probably benign 0.00
R5384:Dcstamp UTSW 15 39759319 missense probably damaging 0.99
R5529:Dcstamp UTSW 15 39754536 missense probably benign 0.04
R5558:Dcstamp UTSW 15 39759540 missense probably damaging 1.00
R5562:Dcstamp UTSW 15 39754402 missense possibly damaging 0.88
R6261:Dcstamp UTSW 15 39754735 missense possibly damaging 0.65
R6299:Dcstamp UTSW 15 39755203 missense probably damaging 1.00
R6377:Dcstamp UTSW 15 39754921 missense probably benign 0.01
R6566:Dcstamp UTSW 15 39754336 missense possibly damaging 0.54
R6596:Dcstamp UTSW 15 39754209 missense possibly damaging 0.95
R6869:Dcstamp UTSW 15 39754458 missense probably damaging 1.00
R7030:Dcstamp UTSW 15 39759533 missense probably damaging 0.96
R7945:Dcstamp UTSW 15 39760401 makesense probably null
R8178:Dcstamp UTSW 15 39755026 missense probably damaging 1.00
Z1177:Dcstamp UTSW 15 39759596 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTAGGAACGCTTTGATTGC -3'
(R):5'- AATCGCTTCAGGAAGAGGC -3'

Sequencing Primer
(F):5'- TTTATAACTTCAGAGGTCTCCTAGAC -3'
(R):5'- CCAGTGCTGACTAGGATGAGC -3'
Posted On2015-10-08