Incidental Mutation 'R0269:Gldc'
ID35171
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 038495-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0269 (G1)
Quality Score219
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30118602 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 670 (I670F)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: I670F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: I670F

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.4957 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.1%
  • 20x: 93.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,954,000 V231I possibly damaging Het
Abca1 T C 4: 53,044,228 D1798G probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Amhr2 T C 15: 102,447,068 C189R probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
AW551984 T C 9: 39,599,950 Y153C probably damaging Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Cd46 T G 1: 195,064,688 I339L probably benign Het
Cdkn2aip A G 8: 47,711,977 S234P probably damaging Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Csf2rb2 G T 15: 78,288,865 T265N probably benign Het
Cyp2c40 A G 19: 39,773,896 F436L probably damaging Het
D130040H23Rik T C 8: 69,300,794 F24S probably benign Het
Defb12 G T 8: 19,114,359 A34E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Guf1 A C 5: 69,559,599 Q168P probably damaging Het
Hcn2 A G 10: 79,734,241 probably benign Het
Hddc2 A G 10: 31,327,946 M190V probably benign Het
Kcnq2 T C 2: 181,096,974 E294G probably benign Het
Kdelr1 T A 7: 45,874,039 probably benign Het
Kidins220 T A 12: 25,040,512 H1158Q probably damaging Het
Laptm5 A T 4: 130,930,816 N185Y probably benign Het
Mgat4a A G 1: 37,490,307 Y164H possibly damaging Het
Mlh3 C A 12: 85,268,405 V336L probably benign Het
Myadm A G 7: 3,296,757 T12A unknown Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr954 T C 9: 39,461,794 M118T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Recql5 T C 11: 115,928,224 D172G possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Rgs7 A G 1: 175,270,820 S58P possibly damaging Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Sgsm1 T C 5: 113,286,929 probably null Het
Slc22a19 A T 19: 7,709,621 probably benign Het
Slc6a21 T A 7: 45,286,908 Y428* probably null Het
Smarca4 T G 9: 21,636,201 M260R probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata17 T C 1: 187,097,872 I322V probably benign Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Sult1d1 A T 5: 87,564,802 I61N probably damaging Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Trmt11 T A 10: 30,587,489 H210L probably benign Het
Ush2a T A 1: 188,810,176 M3313K probably benign Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGTTGACACTGTCCGATTTCACACC -3'
(R):5'- GGCTTTCATGCGAAGGCATTCTG -3'

Sequencing Primer
(F):5'- GTCCGATTTCACACCCCTCC -3'
(R):5'- CCTAACGTGTGTCATAGACAGTC -3'
Posted On2013-05-09