Mutagenetix > Incidental Mutation

Incidental Mutation 'R0269:Gldc'

35171

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

038495-MU

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0269 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30118602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 670 (I670F)

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably damaging
Transcript: ENSMUST00000025778
AA Change: I670F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: I670F

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Meta Mutation Damage Score

0.4957

Coding Region Coverage

1x: 98.7%
3x: 97.8%
10x: 96.1%
20x: 93.6%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	C	T	15: 84,954,000	V231I	possibly damaging	Het
Abca1	T	C	4: 53,044,228	D1798G	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Amhr2	T	C	15: 102,447,068	C189R	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
AW551984	T	C	9: 39,599,950	Y153C	probably damaging	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Cd46	T	G	1: 195,064,688	I339L	probably benign	Het
Cdkn2aip	A	G	8: 47,711,977	S234P	probably damaging	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Csf2rb2	G	T	15: 78,288,865	T265N	probably benign	Het
Cyp2c40	A	G	19: 39,773,896	F436L	probably damaging	Het
D130040H23Rik	T	C	8: 69,300,794	F24S	probably benign	Het
Defb12	G	T	8: 19,114,359	A34E	probably damaging	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Guf1	A	C	5: 69,559,599	Q168P	probably damaging	Het
Hcn2	A	G	10: 79,734,241		probably benign	Het
Hddc2	A	G	10: 31,327,946	M190V	probably benign	Het
Kcnq2	T	C	2: 181,096,974	E294G	probably benign	Het
Kdelr1	T	A	7: 45,874,039		probably benign	Het
Kidins220	T	A	12: 25,040,512	H1158Q	probably damaging	Het
Laptm5	A	T	4: 130,930,816	N185Y	probably benign	Het
Mgat4a	A	G	1: 37,490,307	Y164H	possibly damaging	Het
Mlh3	C	A	12: 85,268,405	V336L	probably benign	Het
Myadm	A	G	7: 3,296,757	T12A	unknown	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr954	T	C	9: 39,461,794	M118T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Recql5	T	C	11: 115,928,224	D172G	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Rgs7	A	G	1: 175,270,820	S58P	possibly damaging	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Sgsm1	T	C	5: 113,286,929		probably null	Het
Slc22a19	A	T	19: 7,709,621		probably benign	Het
Slc6a21	T	A	7: 45,286,908	Y428*	probably null	Het
Smarca4	T	G	9: 21,636,201	M260R	probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata17	T	C	1: 187,097,872	I322V	probably benign	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Sult1d1	A	T	5: 87,564,802	I61N	probably damaging	Het
Sytl2	T	C	7: 90,403,020		probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Trmt11	T	A	10: 30,587,489	H210L	probably benign	Het
Ush2a	T	A	1: 188,810,176	M3313K	probably benign	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- AGTTGACACTGTCCGATTTCACACC -3'
(R):5'- GGCTTTCATGCGAAGGCATTCTG -3'

Sequencing Primer
(F):5'- GTCCGATTTCACACCCCTCC -3'
(R):5'- CCTAACGTGTGTCATAGACAGTC -3'

Posted On

2013-05-09