Incidental Mutation 'R4643:Myef2'
ID351713
Institutional Source Beutler Lab
Gene Symbol Myef2
Ensembl Gene ENSMUSG00000027201
Gene Namemyelin basic protein expression factor 2, repressor
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125084628-125123661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125116811 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 66 (K66R)
Ref Sequence ENSEMBL: ENSMUSP00000114817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
AA Change: K66R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201
AA Change: K66R

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000089825
AA Change: K21R
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201
AA Change: K21R

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
AA Change: K66R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201
AA Change: K66R

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137091
AA Change: K31R
SMART Domains Protein: ENSMUSP00000123222
Gene: ENSMUSG00000027201
AA Change: K31R

DomainStartEndE-ValueType
RRM 58 131 1.84e-22 SMART
low complexity region 164 177 N/A INTRINSIC
RRM 191 263 5.12e-21 SMART
low complexity region 284 301 N/A INTRINSIC
low complexity region 317 342 N/A INTRINSIC
low complexity region 348 376 N/A INTRINSIC
internal_repeat_2 412 441 4.02e-9 PROSPERO
internal_repeat_3 419 444 2.53e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142718
AA Change: K66R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201
AA Change: K66R

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147105
AA Change: K66R

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201
AA Change: K66R

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149911
Predicted Effect probably benign
Transcript: ENSMUST00000152367
AA Change: K66R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201
AA Change: K66R

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Myef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Myef2 APN 2 125115475 missense probably damaging 1.00
IGL01116:Myef2 APN 2 125098482 missense probably damaging 0.99
IGL02197:Myef2 APN 2 125114039 splice site probably null
IGL02525:Myef2 APN 2 125114058 splice site probably benign
IGL02554:Myef2 APN 2 125100425 splice site probably null
IGL03027:Myef2 APN 2 125089034 missense possibly damaging 0.89
R0009:Myef2 UTSW 2 125108978 missense probably benign 0.03
R0510:Myef2 UTSW 2 125109034 splice site probably benign
R0583:Myef2 UTSW 2 125097981 splice site probably null
R1112:Myef2 UTSW 2 125097586 missense probably damaging 1.00
R1656:Myef2 UTSW 2 125097940 splice site probably null
R1682:Myef2 UTSW 2 125098058 missense probably damaging 0.97
R1769:Myef2 UTSW 2 125115443 missense probably damaging 1.00
R1983:Myef2 UTSW 2 125098845 missense probably benign 0.00
R2175:Myef2 UTSW 2 125098455 missense probably damaging 0.99
R4261:Myef2 UTSW 2 125115479 missense possibly damaging 0.77
R4712:Myef2 UTSW 2 125088837 intron probably benign
R4914:Myef2 UTSW 2 125109739 nonsense probably null
R5276:Myef2 UTSW 2 125095721 missense probably damaging 1.00
R5507:Myef2 UTSW 2 125116703 missense probably benign 0.17
R5930:Myef2 UTSW 2 125095731 nonsense probably null
R6335:Myef2 UTSW 2 125109712 missense probably damaging 1.00
R6502:Myef2 UTSW 2 125116682 missense probably damaging 1.00
R7201:Myef2 UTSW 2 125096162 splice site probably null
R7421:Myef2 UTSW 2 125110617 missense probably benign 0.03
R7619:Myef2 UTSW 2 125123476 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAAGTCTGCTTACGTCCTCC -3'
(R):5'- ACAGTATGGAGCTCTCAGGC -3'

Sequencing Primer
(F):5'- GTCCTCCCCTTCCTATACAAAGAC -3'
(R):5'- AGCTCTCAGGCCGGCTTC -3'
Posted On2015-10-08