Incidental Mutation 'R4643:Cyp2j13'
ID351720
Institutional Source Beutler Lab
Gene Symbol Cyp2j13
Ensembl Gene ENSMUSG00000028571
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 13
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96027534-96077546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96056924 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 289 (Q289R)
Ref Sequence ENSEMBL: ENSMUSP00000102693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030305] [ENSMUST00000097973] [ENSMUST00000107078]
Predicted Effect probably benign
Transcript: ENSMUST00000030305
AA Change: Q348R

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030305
Gene: ENSMUSG00000028571
AA Change: Q348R

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 6.7e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097973
AA Change: Q348R

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095587
Gene: ENSMUSG00000028571
AA Change: Q348R

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 404 8.9e-97 PFAM
low complexity region 411 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107078
AA Change: Q289R

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102693
Gene: ENSMUSG00000028571
AA Change: Q289R

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 231 2.5e-39 PFAM
Pfam:p450 218 345 8.6e-41 PFAM
low complexity region 352 361 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132513
AA Change: Q103R
SMART Domains Protein: ENSMUSP00000121962
Gene: ENSMUSG00000028571
AA Change: Q103R

DomainStartEndE-ValueType
Pfam:p450 1 156 2.1e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Cyp2j13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Cyp2j13 APN 4 96062038 missense probably damaging 1.00
IGL01511:Cyp2j13 APN 4 96077315 missense possibly damaging 0.79
IGL01540:Cyp2j13 APN 4 96068722 splice site probably benign
IGL01923:Cyp2j13 APN 4 96062057 missense probably benign 0.00
IGL03124:Cyp2j13 APN 4 96061922 missense possibly damaging 0.78
IGL03389:Cyp2j13 APN 4 96068321 missense probably damaging 1.00
R0671:Cyp2j13 UTSW 4 96071695 missense probably damaging 0.97
R1351:Cyp2j13 UTSW 4 96056918 missense probably benign 0.00
R1510:Cyp2j13 UTSW 4 96061972 missense possibly damaging 0.48
R1708:Cyp2j13 UTSW 4 96062067 missense probably damaging 0.99
R2327:Cyp2j13 UTSW 4 96059107 missense possibly damaging 0.50
R3834:Cyp2j13 UTSW 4 96056557 critical splice donor site probably null
R4867:Cyp2j13 UTSW 4 96058998 missense possibly damaging 0.68
R4900:Cyp2j13 UTSW 4 96059043 missense probably damaging 1.00
R5175:Cyp2j13 UTSW 4 96068215 missense possibly damaging 0.55
R5291:Cyp2j13 UTSW 4 96068329 missense probably damaging 1.00
R5770:Cyp2j13 UTSW 4 96077432 missense probably benign 0.23
R5837:Cyp2j13 UTSW 4 96071682 missense probably damaging 0.98
R5912:Cyp2j13 UTSW 4 96056842 missense probably damaging 1.00
R6283:Cyp2j13 UTSW 4 96056837 missense possibly damaging 0.89
R6362:Cyp2j13 UTSW 4 96071695 missense probably damaging 0.97
R6627:Cyp2j13 UTSW 4 96059106 missense probably damaging 0.96
R7001:Cyp2j13 UTSW 4 96056875 missense probably damaging 1.00
R7356:Cyp2j13 UTSW 4 96077418 missense probably benign 0.23
R7620:Cyp2j13 UTSW 4 96056662 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGACCGCTAGGGAAAGTTAC -3'
(R):5'- GCTGAGCTTCTAAACTGGGC -3'

Sequencing Primer
(F):5'- CCGCTAGGGAAAGTTACAAAGACTC -3'
(R):5'- CTAAACTGGGCTTTTTAAGAGGCAG -3'
Posted On2015-10-08