Incidental Mutation 'R4643:Prdm8'
ID351722
Institutional Source Beutler Lab
Gene Symbol Prdm8
Ensembl Gene ENSMUSG00000035456
Gene NamePR domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location98167198-98188991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98184587 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000147333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112959] [ENSMUST00000210477]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057889
Predicted Effect possibly damaging
Transcript: ENSMUST00000112959
AA Change: S116P

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108583
Gene: ENSMUSG00000035456
AA Change: S116P

DomainStartEndE-ValueType
SET 20 137 1.55e0 SMART
ZnF_C2H2 154 182 2.37e2 SMART
low complexity region 192 219 N/A INTRINSIC
low complexity region 275 291 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 397 427 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 599 621 N/A INTRINSIC
ZnF_C2H2 624 646 9.22e0 SMART
ZnF_C2H2 665 687 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205851
Predicted Effect possibly damaging
Transcript: ENSMUST00000210477
AA Change: S116P

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of histone methyltransferases that predominantly act as negative regulators of transcription. The encoded protein contains an N-terminal Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain and a double zinc-finger domain. Knockout of this gene in mouse results in mistargeting by neurons of the dorsal telencephalon, abnormal itch-like behavior, and impaired differentiation of rod bipolar cells. In humans, the protein has been shown to interact with the phosphatase laforin and the ubiquitin ligase malin, which regulate glycogen construction in the cytoplasm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature termination of corticopsinal motor neuron axons, absent corpus callosum and hippocampal commissure, excessive scratching, skin lesions, and contraction of hindpaws resulting a handstand phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Prdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Prdm8 APN 5 98183343 missense probably damaging 1.00
IGL02208:Prdm8 APN 5 98183465 missense possibly damaging 0.93
IGL02676:Prdm8 APN 5 98186559 missense probably damaging 1.00
R0060:Prdm8 UTSW 5 98185260 missense probably benign 0.19
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0630:Prdm8 UTSW 5 98184521 missense probably damaging 1.00
R1099:Prdm8 UTSW 5 98183502 missense probably damaging 0.99
R4373:Prdm8 UTSW 5 98186508 missense probably damaging 1.00
R4936:Prdm8 UTSW 5 98185022 critical splice acceptor site probably null
R4936:Prdm8 UTSW 5 98185023 critical splice acceptor site probably null
R5033:Prdm8 UTSW 5 98185212 nonsense probably null
R5495:Prdm8 UTSW 5 98185306 missense possibly damaging 0.62
R6307:Prdm8 UTSW 5 98185303 missense possibly damaging 0.84
R6562:Prdm8 UTSW 5 98183343 missense possibly damaging 0.82
R6970:Prdm8 UTSW 5 98184612 missense probably damaging 0.99
R7343:Prdm8 UTSW 5 98184516 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98184632 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98186551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTTCGACTTTGGTCAAC -3'
(R):5'- ACACCTCAGAAGCTTCGTCC -3'

Sequencing Primer
(F):5'- CGACTTTGGTCAACTTTTGCAAAC -3'
(R):5'- TCCACCCTATGATGTGCAAGGTG -3'
Posted On2015-10-08